TB-Profiler result

Run: ERR9786801
Summary

Run ID: ERR9786801

Sample name:

Date: 02-04-2023 12:45:52

Number of reads: 2460902

Percentage reads mapped: 99.59

Strain: lineage4.1

Drug-resistance: Sensitive

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.1 Euro-American T;X;H None 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrB 6507 p.Ala423Val missense_variant 1.0
gyrA 6847 c.-455C>T upstream_gene_variant 1.0
gyrA 7343 c.42G>T synonymous_variant 0.99
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
gyrA 9656 c.2355C>G synonymous_variant 1.0
rpoC 765150 p.Gly594Glu missense_variant 1.0
rpoC 765187 c.1818C>T synonymous_variant 1.0
rpoC 766012 c.2643C>G synonymous_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rpsL 781421 c.-139C>A upstream_gene_variant 1.0
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.39
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
katG 2156007 c.105C>T synonymous_variant 1.0
PPE35 2170231 p.Gln128* stop_gained 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
thyX 3067253 c.693G>A synonymous_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
embC 4239830 c.-33G>T upstream_gene_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embC 4242803 p.Val981Leu missense_variant 1.0
embB 4246118 c.-396G>T upstream_gene_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0