TB-Profiler result

Run: ERR9993217

Summary

Run ID: ERR9993217

Sample name:

Date: 02-04-2023 14:09:03

Number of reads: 3921170

Percentage reads mapped: 99.6

Strain: lineage4.1.1.3

Drug-resistance: RR-TB


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.1 Euro-American T;X;H None 1.0
lineage4.1.1 Euro-American (X-type) X1;X2;X3 None 1.0
lineage4.1.1.3 Euro-American (X-type) X1;X3 RD193 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
rpoB 761155 p.Ser450Leu missense_variant 1.0 rifampicin
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
mshA 576108 p.Ala254Gly missense_variant 0.35
mshA 576111 p.Ala255Gly missense_variant 0.22
rpoC 764670 p.Pro434Leu missense_variant 0.7
rpoC 765150 p.Gly594Glu missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpR5 779392 p.Arg135Trp missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
pncA 2289503 c.-262G>A upstream_gene_variant 0.19
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
fprA 3475111 c.1107_1138delGACCAACAAGAAGGACGCCCAAGACACCGTCG frameshift_variant 1.0
fbiB 3641807 c.273C>G synonymous_variant 0.99
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embC 4242803 p.Val981Leu missense_variant 1.0
embB 4246584 p.Arg24Pro missense_variant 0.21
embB 4249408 c.2895G>A synonymous_variant 1.0
ethR 4327691 p.Asp48Gly missense_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
fprA 3475111 c.1106_1138delGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN disruptive_inframe_deletion 1.0