TB-Profiler result

Run: SRR10993932

Summary

Run ID: SRR10993932

Sample name:

Date: 02-04-2023 19:48:23

Number of reads: 248176

Percentage reads mapped: 99.51

Strain: La1.6

Drug-resistance: Other


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
La1 M.bovis None None 1.0
La1.6 M.bovis None None 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
pncA 2289073 p.His57Asp missense_variant 1.0 pyrazinamide
ethA 4326479 c.993_994dupCG frameshift_variant 0.11 ethionamide
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrB 5752 c.513G>A synonymous_variant 1.0
gyrA 6406 c.-896C>T upstream_gene_variant 1.0
gyrB 6446 p.Ala403Ser missense_variant 1.0
gyrA 7042 c.-260C>T upstream_gene_variant 1.0
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 8285 c.984C>T synonymous_variant 1.0
gyrA 8551 p.Ala417Val missense_variant 0.15
gyrA 9143 c.1842T>C synonymous_variant 1.0
gyrA 9217 p.Asp639Ala missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
gyrA 9448 p.Val716Ala missense_variant 0.13
fgd1 490751 c.-32T>G upstream_gene_variant 0.56
fgd1 490966 p.Gly62Ser missense_variant 0.2
fgd1 491327 p.Ala182Gly missense_variant 0.2
fgd1 491742 c.960T>C synonymous_variant 1.0
ccsA 620768 p.Ala293Gly missense_variant 1.0
rpoC 762458 c.-912C>A upstream_gene_variant 0.15
rpoC 762617 c.-753C>G upstream_gene_variant 0.25
rpoC 763031 c.-339T>C upstream_gene_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpL5 776100 p.Thr794Ile missense_variant 1.0
mmpL5 777368 c.1113G>A synonymous_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rplC 800687 c.-122G>A upstream_gene_variant 0.12
fbiC 1302899 c.-32A>G upstream_gene_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrl 1476022 n.2365A>G non_coding_transcript_exon_variant 1.0
rpsA 1834859 p.Ala440Thr missense_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
ndh 2103173 c.-132delG upstream_gene_variant 1.0
katG 2154180 c.1932C>A synonymous_variant 1.0
katG 2154724 p.Arg463Leu missense_variant 1.0
katG 2155503 c.609C>T synonymous_variant 1.0
katG 2156025 c.87C>A synonymous_variant 1.0
katG 2156372 c.-261C>T upstream_gene_variant 1.0
PPE35 2167926 p.Leu896Ser missense_variant 1.0
PPE35 2168011 p.Ser868Arg missense_variant 1.0
PPE35 2168319 p.Thr765Ile missense_variant 1.0
PPE35 2168814 c.1798dupA frameshift_variant 1.0
Rv1979c 2222308 p.Asp286Gly missense_variant 1.0
Rv1979c 2223062 p.Thr35Ala missense_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
kasA 2518132 c.18C>T synonymous_variant 1.0
kasA 2518983 p.Ala290Val missense_variant 0.18
kasA 2519239 c.1125A>G synonymous_variant 1.0
eis 2714810 p.Phe175Leu missense_variant 0.17
folC 2746245 p.Ala452Thr missense_variant 1.0
folC 2746660 c.938delT frameshift_variant 0.25
ribD 2987615 c.777A>G stop_lost&splice_region_variant 1.0
ald 3086728 c.-92C>T upstream_gene_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
ald 3087084 c.266delA frameshift_variant 1.0
ald 3087307 c.492_537delCGGCGTCGAACCGGCCGACGTCGTGGTGATCGGCGCCGGCACCGCC frameshift_variant 0.15
Rv3083 3448783 p.Val94Ile missense_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
fprA 3474427 p.Val141Ile missense_variant 1.0
fprA 3475159 p.Asn385Asp missense_variant 1.0
rpoA 3878630 c.-124delC upstream_gene_variant 1.0
clpC1 4038403 c.2302T>C synonymous_variant 1.0
embC 4240671 p.Thr270Ile missense_variant 1.0
embC 4241022 p.Ala387Gly missense_variant 0.12
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embA 4242970 c.-263C>T upstream_gene_variant 1.0
embA 4244220 c.988C>T synonymous_variant 1.0
embB 4246551 p.Asn13Ser missense_variant 1.0
embB 4246864 c.351C>T synonymous_variant 1.0
embB 4247646 p.Glu378Ala missense_variant 1.0
embB 4247791 c.1278C>T synonymous_variant 1.0
aftB 4267858 p.Ile327Val missense_variant 1.0
aftB 4269351 c.-515C>T upstream_gene_variant 1.0
ubiA 4269387 p.Glu149Asp missense_variant 1.0
aftB 4269606 c.-770T>C upstream_gene_variant 0.9
ethR 4327981 p.Trp145Arg missense_variant 0.25
whiB6 4338433 p.Pro30Gln missense_variant 0.18
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4407588 c.615A>G synonymous_variant 1.0