TB-Profiler result

Run: SRR12830382


Run ID: SRR12830382

Sample name:

Date: 03-04-2023 06:58:47

Number of reads: 525307

Percentage reads mapped: 99.87

Strain: lineage4.3.4.2

Drug-resistance: Sensitive

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.3 Euro-American (LAM) mainly-LAM None 1.0
lineage4.3.4 Euro-American (LAM) LAM RD174 1.0
lineage4.3.4.2 Euro-American (LAM) LAM1;LAM4;LAM11 RD174 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrB 5196 c.-44G>A upstream_gene_variant 0.13
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 8093 c.792C>A synonymous_variant 0.13
gyrA 9304 p.Gly668Asp missense_variant 1.0
rpoB 760134 p.Lys110Glu missense_variant 0.11
rpoB 761821 p.Ser672Tyr missense_variant 0.13
rpoC 764995 c.1626C>G synonymous_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpL5 776866 p.Met539Val missense_variant 0.12
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.25
Rv1258c 1406518 p.Ala275Ser missense_variant 0.11
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrl 1474864 n.1207C>A non_coding_transcript_exon_variant 0.12
rrl 1475935 n.2278T>G non_coding_transcript_exon_variant 0.18
tlyA 1917972 c.33A>G synonymous_variant 1.0
Rv1979c 2222995 p.Phe57Ser missense_variant 0.12
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
Rv2752c 3065293 p.Val300Ala missense_variant 1.0
thyA 3073821 c.651G>T synonymous_variant 0.13
thyA 3073868 p.Thr202Ala missense_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
Rv3236c 3612009 p.Ala370Thr missense_variant 1.0
clpC1 4038287 c.2418C>T synonymous_variant 1.0
embC 4239763 c.-100C>T upstream_gene_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embB 4247884 c.1371C>A synonymous_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
whiB6 4338699 c.-179delT upstream_gene_variant 0.12
gid 4408156 p.Leu16Arg missense_variant 1.0
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0