TB-Profiler result

Run: SRR16058234

Summary

Run ID: SRR16058234

Sample name:

Date: 03-04-2023 15:34:26

Number of reads: 1504079

Percentage reads mapped: 99.58

Strain: lineage4.8

Drug-resistance: Sensitive


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.8 Euro-American (mainly T) T1;T2;T3;T5 RD219 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrB 7017 p.Ala593Val missense_variant 1.0
gyrA 7362 p.Glu21Gln missense_variant 1.0
rpoC 766085 p.Pro906Ala missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
atpE 1460992 c.-53A>C upstream_gene_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrl 1474001 n.344C>T non_coding_transcript_exon_variant 1.0
fabG1 1673380 c.-60C>G upstream_gene_variant 0.26
tlyA 1917972 c.33A>G synonymous_variant 1.0
PPE35 2168990 c.1545_1622delGGCGATGACGCCAGCTAACATCACGGTGGGTGCGTTTGATTTGCCGGGGTTGACGGTGCCGTCGTTGACGATTCCAGC disruptive_inframe_deletion 1.0
PPE35 2169071 c.1542A>G synonymous_variant 0.1
PPE35 2170048 p.Leu189Val missense_variant 0.19
PPE35 2170053 p.Thr187Ser missense_variant 0.18
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
kasA 2518051 c.-64A>G upstream_gene_variant 1.0
whiB7 3568503 c.177G>T synonymous_variant 1.0
alr 3840764 c.657G>C synonymous_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embB 4246544 p.Thr11Pro missense_variant 0.17
embB 4247151 p.Arg213Gln missense_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
PPE35 2168990 c.1544_1622delNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT frameshift_variant 1.0
Rv3083 3448507 c.5_*1408del frameshift_variant&stop_lost&splice_region_variant 1.0