TB-Profiler result

Run: SRR16151372

Summary

Run ID: SRR16151372

Sample name:

Date: 03-04-2023 16:31:25

Number of reads: 1919792

Percentage reads mapped: 99.76

Strain: lineage4.4.1.1

Drug-resistance: Sensitive


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.4 Euro-American S;T None 0.98
lineage4.4.1.1 Euro-American S;Orphans None 0.97
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9138 p.Gln613Glu missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpL5 777416 c.1065G>T synonymous_variant 0.97
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1304047 p.Ala373Thr missense_variant 0.11
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
ndh 2102990 p.Val18Ala missense_variant 0.98
PPE35 2168479 p.Thr712Pro missense_variant 1.0
PPE35 2168990 c.1545_1622delGGCGATGACGCCAGCTAACATCACGGTGGGTGCGTTTGATTTGCCGGGGTTGACGGTGCCGTCGTTGACGATTCCAGC disruptive_inframe_deletion 0.86
PPE35 2169071 c.1542A>G synonymous_variant 0.19
PPE35 2169840 p.Gly258Asp missense_variant 0.93
Rv1979c 2222998 p.Ile56Ser missense_variant 0.99
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
Rv2752c 3065263 p.Glu310Ala missense_variant 0.95
ald 3086788 c.-32T>C upstream_gene_variant 1.0
Rv3083 3448608 c.105G>A synonymous_variant 0.94
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
whiB7 3568779 c.-100T>C upstream_gene_variant 0.99
Rv3236c 3612665 p.Val151Ala missense_variant 1.0
fbiB 3642720 c.1187_1188dupGC frameshift_variant 0.97
embA 4242643 c.-590C>T upstream_gene_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
PPE35 2168990 c.1544_1622delNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT frameshift_variant 1.0