TB-Profiler result

Run: SRR19226954

Summary

Run ID: SRR19226954

Sample name:

Date: 03-04-2023 20:59:32

Number of reads: 1606074

Percentage reads mapped: 99.5

Strain: lineage4.1.2.1

Drug-resistance: Sensitive


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.1 Euro-American T;X;H None 1.0
lineage4.1.2 Euro-American T;H None 1.0
lineage4.1.2.1 Euro-American (Haarlem) T1;H1 RD182 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
fgd1 491591 p.Lys270Met missense_variant 1.0
mshA 575679 p.Asn111Ser missense_variant 1.0
rpoB 760115 c.309C>T synonymous_variant 1.0
rpoC 765150 p.Gly594Glu missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrl 1474383 n.726G>T non_coding_transcript_exon_variant 0.11
rrl 1474387 n.730C>T non_coding_transcript_exon_variant 0.11
rrl 1474409 n.756_776delACCCACACGCGCATACGCGCG non_coding_transcript_exon_variant 0.14
rrl 1474435 n.778G>T non_coding_transcript_exon_variant 0.12
rrl 1474437 n.782_784delATA non_coding_transcript_exon_variant 0.12
rrl 1474447 n.790G>A non_coding_transcript_exon_variant 0.12
rrl 1474450 n.793T>A non_coding_transcript_exon_variant 0.12
rrl 1474451 n.794T>C non_coding_transcript_exon_variant 0.12
rrl 1474454 n.797G>A non_coding_transcript_exon_variant 0.12
rrl 1474476 n.819C>T non_coding_transcript_exon_variant 0.11
rrl 1474478 n.821C>T non_coding_transcript_exon_variant 0.11
rrl 1474488 n.831G>T non_coding_transcript_exon_variant 0.11
rrl 1474496 n.839C>A non_coding_transcript_exon_variant 0.12
rrl 1474497 n.840G>C non_coding_transcript_exon_variant 0.12
rrl 1474506 n.849C>G non_coding_transcript_exon_variant 0.12
rrl 1474507 n.850G>T non_coding_transcript_exon_variant 0.12
rrl 1474516 n.859C>A non_coding_transcript_exon_variant 0.12
rrl 1474529 n.872A>C non_coding_transcript_exon_variant 0.11
rrl 1474530 n.873G>A non_coding_transcript_exon_variant 0.11
rrl 1474537 n.880G>A non_coding_transcript_exon_variant 0.11
rrl 1474539 n.882C>T non_coding_transcript_exon_variant 0.11
rrl 1474540 n.883T>G non_coding_transcript_exon_variant 0.11
rrl 1474558 n.901G>A non_coding_transcript_exon_variant 0.1
rrl 1476381 n.2724G>C non_coding_transcript_exon_variant 0.13
tlyA 1917972 c.33A>G synonymous_variant 1.0
tlyA 1918677 c.738G>A synonymous_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
kasA 2518076 c.-39C>T upstream_gene_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embC 4242803 p.Val981Leu missense_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0