TB-Profiler result

Run: SRR19428522

Summary

Run ID: SRR19428522

Sample name:

Date: 03-04-2023 21:38:59

Number of reads: 397902

Percentage reads mapped: 99.4

Strain: lineage3.1.1

Drug-resistance: Sensitive


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage3 East-African-Indian CAS RD750 1.0
lineage3.1 East-African-Indian Non-CAS1-Delhi RD750 1.0
lineage3.1.1 East-African-Indian CAS1-Kili RD750 0.99
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrB 6462 p.Asn408Ser missense_variant 0.17
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9147 p.Gly616Arg missense_variant 0.11
gyrA 9304 p.Gly668Asp missense_variant 1.0
gyrA 9603 p.Val768Ile missense_variant 0.2
gyrA 9676 p.Arg792Leu missense_variant 0.17
fgd1 491329 p.Lys183Glu missense_variant 0.22
fgd1 491742 c.960T>C synonymous_variant 1.0
rpoB 759746 c.-61C>T upstream_gene_variant 1.0
rpoB 760177 p.Ala124Glu missense_variant 0.2
rpoB 762400 p.Val865Glu missense_variant 0.11
rpoC 762434 c.-936T>G upstream_gene_variant 1.0
rpoC 763031 c.-339T>C upstream_gene_variant 1.0
rpoB 763095 p.Tyr1097His missense_variant 0.12
rpoC 763965 p.Asp199Val missense_variant 0.17
rpoC 764673 p.Gln435Arg missense_variant 0.12
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpL5 776100 p.Thr794Ile missense_variant 1.0
mmpL5 777576 p.Met302Lys missense_variant 0.2
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rpsL 781564 p.Pro2Gln missense_variant 0.15
rpsL 781904 p.Ser115Arg missense_variant 0.17
rplC 801324 p.Asn172Lys missense_variant 0.12
fbiC 1304890 p.Ile654Phe missense_variant 0.12
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.25
Rv1258c 1406360 c.981C>A synonymous_variant 0.11
embR 1417463 c.-116A>T upstream_gene_variant 0.12
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrs 1471961 n.116C>A non_coding_transcript_exon_variant 0.17
rrs 1472722 n.881dupG non_coding_transcript_exon_variant 0.22
rrs 1473333 n.1488T>A non_coding_transcript_exon_variant 0.22
rrl 1475376 n.1719A>G non_coding_transcript_exon_variant 0.15
rrl 1476501 n.2844C>A non_coding_transcript_exon_variant 0.4
fabG1 1673380 c.-60C>G upstream_gene_variant 0.12
fabG1 1673428 c.-12T>A upstream_gene_variant 0.12
fabG1 1673828 p.Asn130Ser missense_variant 0.12
tlyA 1917972 c.33A>G synonymous_variant 1.0
ndh 2102931 p.Val38Ile missense_variant 0.12
katG 2154724 p.Arg463Leu missense_variant 1.0
katG 2155221 c.891C>A synonymous_variant 0.18
PPE35 2167926 p.Leu896Ser missense_variant 1.0
PPE35 2169043 p.Val524Met missense_variant 0.2
PPE35 2170461 p.Gly51Glu missense_variant 1.0
PPE35 2170697 c.-85T>C upstream_gene_variant 0.13
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
pncA 2288861 c.381G>A synonymous_variant 0.11
pncA 2289026 c.216C>T synonymous_variant 0.11
pncA 2289047 c.195C>T synonymous_variant 1.0
pncA 2289365 c.-125delC upstream_gene_variant 1.0
kasA 2518467 p.Gly118Val missense_variant 0.12
kasA 2518556 p.Asn148Asp missense_variant 0.29
kasA 2519068 c.954C>T synonymous_variant 0.18
kasA 2519353 c.1239C>T synonymous_variant 0.11
eis 2714248 p.Gly362Glu missense_variant 0.11
ahpC 2726105 c.-88G>A upstream_gene_variant 1.0
folC 2747495 p.Asp35Val missense_variant 0.11
pepQ 2859668 p.Gln251Glu missense_variant 0.11
thyX 3067504 p.Ala148Ser missense_variant 0.12
ald 3086788 c.-32T>C upstream_gene_variant 1.0
Rv3083 3448487 c.-16delC upstream_gene_variant 0.12
Rv3083 3448806 c.303C>A synonymous_variant 0.12
Rv3083 3449964 c.1461A>C synonymous_variant 0.11
Rv3083 3449982 c.1479G>T synonymous_variant 0.12
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
whiB7 3568626 c.53delT frameshift_variant 0.11
Rv3236c 3612049 c.1068G>A synonymous_variant 0.12
Rv3236c 3613128 c.-12A>G upstream_gene_variant 0.27
fbiA 3640880 c.340dupG frameshift_variant 0.12
fbiA 3640888 c.349delC frameshift_variant 0.13
fbiA 3640960 p.Ala140Pro missense_variant 0.14
fbiB 3641766 p.Ile78Phe missense_variant 0.11
fbiB 3642187 p.Arg218Leu missense_variant 0.11
alr 3841040 p.Asp127Glu missense_variant 0.11
rpoA 3877954 p.Gln185Leu missense_variant 0.13
clpC1 4040820 c.-117delC upstream_gene_variant 0.11
panD 4044275 p.Arg3Trp missense_variant 0.11
embC 4239901 c.39G>A synonymous_variant 0.11
embC 4240172 p.Val104Met missense_variant 1.0
embC 4241562 p.Arg567His missense_variant 1.0
embC 4241851 c.1989C>G synonymous_variant 0.12
embC 4242075 p.Arg738Gln missense_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
aftB 4267056 c.1780delT frameshift_variant 0.13
aftB 4268389 c.447delG frameshift_variant 0.12
ethA 4326566 p.Arg303Gln missense_variant 0.12
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4407588 c.615A>G synonymous_variant 1.0