TB-Profiler result

Run: SRR21658542
Summary

Run ID: SRR21658542

Sample name:

Date: 04-04-2023 02:22:50

Number of reads: 1610139

Percentage reads mapped: 99.63

Strain: lineage4.1.2.1

Drug-resistance: Sensitive

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.1 Euro-American T;X;H None 1.0
lineage4.1.2 Euro-American T;H None 1.0
lineage4.1.2.1 Euro-American (Haarlem) T1;H1 RD182 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
fgd1 491591 p.Lys270Met missense_variant 1.0
mshA 575679 p.Asn111Ser missense_variant 1.0
rpoB 760115 c.309C>T synonymous_variant 1.0
rpoC 765150 p.Gly594Glu missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.22
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrl 1473937 n.280C>T non_coding_transcript_exon_variant 0.13
rrl 1475284 n.1627C>A non_coding_transcript_exon_variant 0.17
rrl 1475371 n.1715delA non_coding_transcript_exon_variant 0.12
rrl 1475990 n.2333G>C non_coding_transcript_exon_variant 0.1
rrl 1476066 n.2409T>C non_coding_transcript_exon_variant 0.12
rrl 1476104 n.2447T>C non_coding_transcript_exon_variant 0.1
rrl 1476320 n.2663A>G non_coding_transcript_exon_variant 0.12
tlyA 1917972 c.33A>G synonymous_variant 1.0
PPE35 2168813 c.1722_1799delAGCGCTAGGTGCGTTCAATCTGCCGACGCTGAGTATTCCGTCGGTGACGGTTCCGCCGATCACGATTCCGGCTGGCAC disruptive_inframe_deletion 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
kasA 2518076 c.-39C>T upstream_gene_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
rpoA 3878513 c.-6A>G upstream_gene_variant 0.1
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embC 4242803 p.Val981Leu missense_variant 1.0
ethA 4326470 p.Ala335Asp missense_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4407705 c.494_497dupAGCG frameshift_variant 0.98
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0
PPE35 2168813 c.1721_1799delNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNC frameshift_variant 1.0