TB-Profiler result

Run: SRR21685361

Summary

Run ID: SRR21685361

Sample name:

Date: 04-04-2023 02:55:06

Number of reads: 1831203

Percentage reads mapped: 99.67

Strain: lineage4.1.1.2

Drug-resistance: Sensitive


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.1 Euro-American T;X;H None 1.0
lineage4.1.1 Euro-American (X-type) X1;X2;X3 None 1.0
lineage4.1.1.2 Euro-American (X-type) X1 None 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
rpoC 764617 c.1248C>T synonymous_variant 1.0
rpoC 765150 p.Gly594Glu missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
PPE35 2168813 c.1722_1799delAGCGCTAGGTGCGTTCAATCTGCCGACGCTGAGTATTCCGTCGGTGACGGTTCCGCCGATCACGATTCCGGCTGGCAC disruptive_inframe_deletion 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
Rv3083 3449787 c.1284C>T synonymous_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embC 4242803 p.Val981Leu missense_variant 1.0
embA 4243833 p.Ala201Thr missense_variant 1.0
embB 4246930 p.Gln139His missense_variant 1.0
embB 4249408 c.2895G>A synonymous_variant 1.0
aftB 4268135 c.702G>C synonymous_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
PPE35 2168813 c.1721_1799delNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNC frameshift_variant 1.0