TB-Profiler result

Run: SRR22048358

Summary

Run ID: SRR22048358

Sample name:

Date: 04-04-2023 03:50:22

Number of reads: 10784751

Percentage reads mapped: 99.22

Strain: lineage4.7

Drug-resistance: MDR-TB


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.7 Euro-American (mainly T) T1;T5 None 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
rpoB 761155 p.Ser450Leu missense_variant 1.0 rifampicin
katG 2155168 p.Ser315Thr missense_variant 1.0 isoniazid
embB 4247429 p.Met306Val missense_variant 1.0 ethambutol
gid 4408100 c.102delG frameshift_variant 1.0 streptomycin
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
fgd1 490690 c.-92_-38delGCGGGTCGCGACCATGGGATATGGAGCGATCGCGAGCGCGGCGAAGCCGGGCGTG upstream_gene_variant 1.0
mshA 576108 p.Ala254Gly missense_variant 0.27
rpoC 766487 p.Pro1040Ala missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrs 1472143 n.298_299insT non_coding_transcript_exon_variant 1.0
rrl 1474294 n.637C>G non_coding_transcript_exon_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
PPE35 2170675 c.-63G>C upstream_gene_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
pepQ 2860505 c.-87G>C upstream_gene_variant 1.0
Rv2752c 3065092 p.Gln367Pro missense_variant 1.0
rpoA 3878599 c.-92C>G upstream_gene_variant 1.0
rpoA 3878624 c.-117C>T upstream_gene_variant 0.17
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embA 4245316 p.Val695Ala missense_variant 1.0
embB 4246584 p.Arg24Pro missense_variant 0.24
embB 4249732 c.3219C>G synonymous_variant 1.0
ethA 4326497 p.Arg326Gln missense_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0