TB-Profiler result

Run: SRR24827280


Run ID: SRR24827280

Sample name:

Date: 2024-03-26T13:12:03.929837

Number of reads: 3873269

Percentage reads mapped: 99.36

Median coverage: 197.0

Strain: lineage4.2.2


Drug-resistance: RR-TB

Download CSV Download TXT Download JSON
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family RDs Frequency
lineage4.2.2 Euro-American (Ural) None 0.99
lineage4.2 Euro-American None 1.0
lineage4 Euro-American None 1.0
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations WHO confidence Comment
rifampicin rpoB p.His445Asp Assoc w R
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence Comment
rpoB 761139 p.His445Asp missense_variant 0.99 rifampicin Assoc w R
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence
gyrB 4977 c.-263C>T upstream_gene_variant 0.99 levofloxacin
gyrA 7362 p.Glu21Gln missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 7585 p.Ser95Thr missense_variant 0.99 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 8500 p.Ala400Val missense_variant 1.0 levofloxacin Uncertain significance
moxifloxacin Uncertain significance
gyrA 9304 p.Gly668Asp missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
mshA 574913 c.-435T>G upstream_gene_variant 0.19 ethionamide Uncertain significance
isoniazid Uncertain significance
mshA 576077 c.730C>T synonymous_variant 1.0 ethionamide Not assoc w R - Interim
isoniazid Not assoc w R
mmpL5 775639 p.Ile948Val missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
rpsL 781395 c.-165T>C upstream_gene_variant 1.0 streptomycin Not assoc w R
rplC 800204 c.-605T>C upstream_gene_variant 1.0 linezolid
embR 1416724 p.Trp208* stop_gained 1.0 ethambutol Uncertain significance
rrs 1471659 n.-187C>T upstream_gene_variant 1.0 streptomycin
tsnR 1854300 p.Leu232Pro missense_variant 1.0 linezolid Not assoc w R
tlyA 1917972 c.33A>G synonymous_variant 1.0 capreomycin Not assoc w R
bacA 2063685 c.1044G>A synonymous_variant 1.0 streptomycin Not assoc w R - Interim
kanamycin Not assoc w R - Interim
capreomycin Not assoc w R
amikacin Not assoc w R
bacA 2063911 p.Ile273Thr missense_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
Rv1979c 2223770 c.-669_-607delTGGAAAATTACATCGCCCAGACGCGCGACAAGTTCCTCAGCGCGGCCACATCGTCCACTCCAC upstream_gene_variant 1.0 clofazimine
Rv2752c 3066280 c.-89C>T upstream_gene_variant 1.0 ethambutol
ald 3086742 c.-78A>C upstream_gene_variant 1.0 cycloserine
ald 3086788 c.-32T>C upstream_gene_variant 1.0 cycloserine
Rv3236c 3612469 c.648A>G synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
mtrB 3625065 p.Met517Leu missense_variant 1.0 bedaquiline Uncertain significance
rifampicin Not assoc w R
alr 3841567 c.-147A>G upstream_gene_variant 1.0 cycloserine
ddn 3987217 p.Gln125Pro missense_variant 1.0 delamanid
clpC1 4039415 p.Glu430Asp missense_variant 1.0 pyrazinamide Uncertain significance
embC 4239064 c.-799C>T upstream_gene_variant 1.0 ethambutol Uncertain significance
embC 4242643 c.2781C>T synonymous_variant 0.98 ethambutol Not assoc w R
ethA 4326493 c.981G>A synonymous_variant 1.0 ethionamide Not assoc w R - Interim
whiB6 4338595 c.-75delG upstream_gene_variant 1.0 capreomycin Not assoc w R
amikacin Not assoc w R
kanamycin Not assoc w R
whiB6 4338732 c.-211C>T upstream_gene_variant 1.0 capreomycin