TB-Profiler result

Run: SRR6824336

Summary

Run ID: SRR6824336

Sample name:

Date: 04-04-2023 16:27:58

Number of reads: 2138218

Percentage reads mapped: 98.61

Strain: lineage4.5

Drug-resistance: MDR-TB


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.5 Euro-American H;T RD122 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
rpoB 761139 p.His445Asp missense_variant 0.69 rifampicin
ahpC 2726141 c.-52C>T upstream_gene_variant 0.57 isoniazid
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 7892 c.591G>A synonymous_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
ccsA 620029 c.139C>T synonymous_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
Rv1258c 1406482 p.Arg287Cys missense_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rpsA 1833734 p.Ala65Thr missense_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
katG 2154958 p.Arg385Pro missense_variant 0.71
PPE35 2170568 p.Ile15Met missense_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
eis 2714211 c.1122G>A synonymous_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
rpoA 3878575 c.-68C>T upstream_gene_variant 1.0
rpoA 3878580 c.-113_-74delCAACCCAACCCTCGGGGGGCGCCGCCCCCCGAGTACCCCC upstream_gene_variant 1.0
clpC1 4038318 p.Pro796Leu missense_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
whiB6 4338636 c.-115C>A upstream_gene_variant 1.0