TB-Profiler result

Run: SRR6982226

Summary

Run ID: SRR6982226

Sample name:

Date: 04-04-2023 18:31:10

Number of reads: 750275

Percentage reads mapped: 99.44

Strain: lineage4.1

Drug-resistance: Sensitive


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.1 Euro-American T;X;H None 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 8694 c.1393C>T synonymous_variant 0.95
gyrA 8705 c.1404C>T synonymous_variant 0.95
gyrA 9304 p.Gly668Asp missense_variant 1.0
rpoC 765150 p.Gly594Glu missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.43
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rpsA 1834348 c.807T>C synonymous_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
pepQ 2859333 p.Leu362Phe missense_variant 0.13
ribD 2987195 c.357C>A synonymous_variant 0.11
ribD 2987296 p.Arg153Leu missense_variant 0.1
thyA 3074489 c.-18G>A upstream_gene_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
fprA 3475346 p.Leu447Arg missense_variant 1.0
Rv3236c 3612515 p.Arg201His missense_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embC 4242803 p.Val981Leu missense_variant 1.0
embB 4249408 c.2895G>A synonymous_variant 1.0
embB 4249549 c.3036C>T synonymous_variant 0.13
aftB 4267884 p.Ser318Asn missense_variant 0.12
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4408031 p.Leu58Phe missense_variant 1.0
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0