TB-Profiler result

Run: SRR7535051

Summary

Run ID: SRR7535051

Sample name:

Date: 04-04-2023 19:42:55

Number of reads: 8784896

Percentage reads mapped: 99.28

Strain: lineage4.6.1

Drug-resistance: Sensitive


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.6 Euro-American T;LAM None 0.99
lineage4.6.1 Euro-American (Uganda) T2 RD724 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7539 p.Thr80Ala missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
tlyA 1918198 p.Leu87Val missense_variant 0.98
PPE35 2167825 c.2754_2787delTTGGTTCAACACAAGTCCTGTTGGGCTGCTAGCC frameshift_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
Rv2752c 3064985 p.Leu403Met missense_variant 1.0
ald 3086750 c.-70A>C upstream_gene_variant 0.98
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embA 4243557 p.Ala109Thr missense_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4407712 p.Gly164Asp missense_variant 1.0
PPE35 2167825 c.2753_2787delNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG frameshift_variant 1.0