TB-Profiler result

Run: ERR11049064

Summary

Run ID: ERR11049064

Sample name:

Date: 31-03-2023 08:37:44

Number of reads: 540858

Percentage reads mapped: 99.46

Strain: lineage9

Drug-resistance: Other


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage9 Lineage 9 None None 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
ethA 4327212 c.239_261dupCCATCCTCGAGTACGTCAAGAGC frameshift_variant 0.4 ethionamide
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrB 6446 p.Ala403Ser missense_variant 1.0
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9143 c.1842T>C synonymous_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
gyrA 9647 c.2346C>G synonymous_variant 0.13
fgd1 490726 c.-57G>A upstream_gene_variant 0.33
fgd1 490756 c.-27T>G upstream_gene_variant 0.33
fgd1 491742 c.960T>C synonymous_variant 1.0
mshA 575266 c.-82G>A upstream_gene_variant 0.14
mshA 575467 c.120A>T synonymous_variant 0.33
ccsA 620361 c.471C>T synonymous_variant 0.14
ccsA 620407 p.Pro173Thr missense_variant 0.13
ccsA 620719 p.Ala277Ser missense_variant 0.3
ccsA 620724 c.834C>T synonymous_variant 0.2
rpoB 759738 c.-69G>A upstream_gene_variant 0.2
rpoB 760009 p.Ala68Val missense_variant 1.0
rpoB 761874 p.Val690Ile missense_variant 0.18
rpoB 762637 c.2836delG frameshift_variant 0.14
rpoC 763031 c.-339T>C upstream_gene_variant 1.0
rpoC 763767 p.Ala133Val missense_variant 0.2
rpoC 764537 p.Pro390Ala missense_variant 0.33
rpoC 767219 c.3852dupC frameshift_variant 0.18
mmpL5 775618 p.Pro955Thr missense_variant 0.11
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpL5 776100 p.Thr794Ile missense_variant 1.0
mmpR5 778067 c.-923G>A upstream_gene_variant 0.22
mmpL5 778260 c.220delT frameshift_variant 0.12
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1302899 c.-32A>G upstream_gene_variant 1.0
fbiC 1303149 c.219C>G synonymous_variant 0.25
fbiC 1303617 c.689_690dupAC frameshift_variant 0.18
fbiC 1305234 c.2304G>A synonymous_variant 0.18
fbiC 1305492 c.2562T>A synonymous_variant 0.15
embR 1416873 p.Val159Ile missense_variant 0.25
embR 1417196 p.Gly51Val missense_variant 0.15
atpE 1461109 p.Ile22Asn missense_variant 0.2
atpE 1461251 c.207G>T synonymous_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrs 1471970 n.125G>A non_coding_transcript_exon_variant 1.0
rrl 1474432 n.775C>A non_coding_transcript_exon_variant 0.25
rrl 1475017 n.1360G>A non_coding_transcript_exon_variant 1.0
rrl 1476075 n.2418G>A non_coding_transcript_exon_variant 0.15
inhA 1674434 p.Val78Ala missense_variant 1.0
rpsA 1834067 p.Leu176Met missense_variant 0.17
tlyA 1917972 c.33A>G synonymous_variant 1.0
tlyA 1918343 p.Asn135Ile missense_variant 0.18
ndh 2101961 p.Pro361Gln missense_variant 0.15
ndh 2102072 p.Ala324Val missense_variant 1.0
katG 2154599 p.Trp505Gly missense_variant 0.3
katG 2154724 p.Arg463Leu missense_variant 1.0
katG 2155503 c.609C>T synonymous_variant 1.0
PPE35 2167926 p.Leu896Ser missense_variant 1.0
PPE35 2168043 p.Ala857Val missense_variant 0.17
PPE35 2168307 p.Phe769Ser missense_variant 0.2
Rv1979c 2222308 p.Asp286Gly missense_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
kasA 2518132 c.18C>T synonymous_variant 1.0
kasA 2518347 p.Arg78Gln missense_variant 0.12
kasA 2518497 p.Leu128Pro missense_variant 0.12
kasA 2518561 c.447T>A synonymous_variant 0.17
kasA 2519075 p.Ala321Pro missense_variant 0.29
eis 2715502 c.-170C>T upstream_gene_variant 0.29
pepQ 2859616 p.Ala268Val missense_variant 0.14
pepQ 2860013 p.Asp136His missense_variant 0.29
pepQ 2860159 p.Ala87Gly missense_variant 0.2
pepQ 2860561 c.-143C>A upstream_gene_variant 1.0
ribD 2987006 p.Asp56Glu missense_variant 0.17
ribD 2987183 c.346delC frameshift_variant 0.13
Rv2752c 3065102 p.Thr364Pro missense_variant 0.29
Rv2752c 3066099 p.Met31Ile missense_variant 1.0
thyX 3067630 p.Gln106Lys missense_variant 0.17
ald 3086728 c.-92C>T upstream_gene_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
ald 3087084 c.266delA frameshift_variant 1.0
ald 3087782 c.963G>T synonymous_variant 1.0
ald 3087816 p.Cys333Gly missense_variant 0.4
fprA 3473823 c.-184G>A upstream_gene_variant 0.15
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
fprA 3475159 p.Asn385Asp missense_variant 1.0
Rv3236c 3612087 p.Ala344Thr missense_variant 0.12
alr 3840378 p.Val348Gly missense_variant 0.2
rpoA 3878155 p.Val118Glu missense_variant 0.14
ddn 3986775 c.-69A>C upstream_gene_variant 0.15
clpC1 4038395 c.2310C>T synonymous_variant 0.22
clpC1 4038496 p.Arg737Trp missense_variant 0.12
embC 4240409 p.Pro183Ala missense_variant 0.67
embC 4240671 p.Thr270Ile missense_variant 1.0
embC 4241489 p.Ala543Thr missense_variant 1.0
embC 4241938 c.2076G>A synonymous_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embA 4243585 p.Phe118Ser missense_variant 0.21
embA 4244220 c.988C>T synonymous_variant 1.0
embA 4245447 p.Val739Met missense_variant 0.13
embB 4246864 c.351C>T synonymous_variant 1.0
embB 4247646 p.Glu378Ala missense_variant 1.0
embB 4248328 c.1815G>C synonymous_variant 0.25
embB 4248409 c.1896A>G synonymous_variant 0.12
embB 4248887 p.Gly792Arg missense_variant 0.33
ubiA 4269053 p.Arg261Cys missense_variant 0.12
aftB 4269351 c.-515C>T upstream_gene_variant 1.0
ubiA 4269387 p.Glu149Asp missense_variant 1.0
aftB 4269606 c.-770T>C upstream_gene_variant 1.0
ubiA 4269847 c.-14A>G upstream_gene_variant 1.0
ethA 4326166 c.1308A>T synonymous_variant 0.12
ethA 4328415 c.-942A>G upstream_gene_variant 0.2
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4407588 c.615A>G synonymous_variant 1.0
gid 4407876 c.327C>T synonymous_variant 1.0
gid 4408457 c.-255A>G upstream_gene_variant 1.0