TB-Profiler result

Run: ERR11050312

Summary

Run ID: ERR11050312

Sample name:

Date: 02-04-2023 22:18:16

Number of reads: 4382195

Percentage reads mapped: 99.66

Strain: lineage4.1.2.1

Drug-resistance: Sensitive


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.1 Euro-American T;X;H None 1.0
lineage4.1.2 Euro-American T;H None 1.0
lineage4.1.2.1 Euro-American (Haarlem) T1;H1 RD182 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 0.99
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
fgd1 491591 p.Lys270Met missense_variant 1.0
mshA 575679 p.Asn111Ser missense_variant 1.0
rpoB 760115 c.309C>T synonymous_variant 0.99
rpoC 765150 p.Gly594Glu missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpS5 778842 p.Gly22Arg missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
embR 1417483 c.-136A>C upstream_gene_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
fabG1 1673553 p.Asp38Glu missense_variant 0.18
tlyA 1917972 c.33A>G synonymous_variant 1.0
PPE35 2170065 p.Ala183Gly missense_variant 0.21
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
kasA 2518076 c.-39C>T upstream_gene_variant 1.0
pepQ 2860159 p.Ala87Gly missense_variant 0.21
thyA 3074494 c.-80_-24delCGCTGGGTTTGTTTGGCGGCGAGTCGCTGCGGCGGCTTCGCCGCGCTTGCGATCGCC upstream_gene_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fbiD 3339734 p.Ala206Gly missense_variant 0.54
fbiD 3339746 p.Ala210Gly missense_variant 0.31
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
rpoA 3878613 c.-106A>C upstream_gene_variant 0.2
rpoA 3878641 c.-134C>G upstream_gene_variant 0.41
embA 4242643 c.-590C>T upstream_gene_variant 0.99
embC 4242803 p.Val981Leu missense_variant 1.0
embB 4246584 p.Arg24Pro missense_variant 0.37
whiB6 4338595 c.-75delG upstream_gene_variant 1.0