Run ID: ERR13260621
Sample name:
Date: 2025-02-11T17:58:18.163554
Number of reads: 6949796
Percentage reads mapped: 99.74
Median coverage: 214.0
Strain: lineage4
Spoligotype:
Drug-resistance: Pre-XDR-TB
| Lineage | Family | RDs | Frequency |
|---|---|---|---|
| lineage4 | Euro-American | None | 1.0 |
| Drug | Resistance | Supporting mutations | WHO confidence | Comment |
|---|---|---|---|---|
| rifampicin | rpoB | p.Ser450Leu | Assoc w R | |
| isoniazid | katG | p.Ser315Thr | Assoc w R | High-level resistance |
| ethambutol | embA | c.-16C>T | Uncertain significance | Mutation from literature |
| embB | p.Met306Ile | Assoc w R | ||
| pyrazinamide | pncA | p.Phe106Ser | Assoc w R - Interim | |
| streptomycin | gid | c.597delC | Assoc w R | |
| fluoroquinolones | ||||
| moxifloxacin | gyrA | p.Ser91Pro | Assoc w R | Low-level resistance (multiple, genetically linked low-level resistance mutations are additive and confer high-level resistance) |
| ofloxacin | ||||
| levofloxacin | gyrA | p.Ser91Pro | Assoc w R | |
| ciprofloxacin | ||||
| aminoglycosides | ||||
| amikacin | ||||
| capreomycin | ||||
| kanamycin | ||||
| cycloserine | ||||
| ethionamide | ||||
| clofazimine | ||||
| para-aminosalicylic_acid | ||||
| delamanid | ||||
| bedaquiline | ||||
| linezolid |
| Gene | Chromosome position | Mutation | Type | Estimated fraction | Drugs | Confidence | Comment |
|---|---|---|---|---|---|---|---|
| gyrA | 7572 | p.Ser91Pro | missense_variant | 1.0 | levofloxacin | Assoc w R | |
| moxifloxacin | Assoc w R | Low-level resistance (multiple, genetically linked low-level resistance mutations are additive and confer high-level resistance) | |||||
| rpoB | 761155 | p.Ser450Leu | missense_variant | 1.0 | rifampicin | Assoc w R | |
| katG | 2155168 | p.Ser315Thr | missense_variant | 1.0 | isoniazid | Assoc w R | High-level resistance |
| pncA | 2288925 | p.Phe106Ser | missense_variant | 1.0 | pyrazinamide | Assoc w R - Interim | |
| embA | 4243217 | c.-16C>T | upstream_gene_variant | 1.0 | ethambutol | Uncertain significance | Mutation from literature |
| embB | 4247431 | p.Met306Ile | missense_variant | 1.0 | ethambutol | Assoc w R | |
| gid | 4407605 | c.597delC | frameshift_variant | 1.0 | streptomycin | Assoc w R |
| Gene | Chromosome position | Mutation | Type | Estimated fraction | Drugs | Confidence |
|---|---|---|---|---|---|---|
| gyrA | 7362 | p.Glu21Gln | missense_variant | 1.0 | levofloxacin | Not assoc w R |
| moxifloxacin | Not assoc w R | |||||
| gyrA | 7585 | p.Ser95Thr | missense_variant | 1.0 | levofloxacin | Not assoc w R |
| moxifloxacin | Not assoc w R | |||||
| gyrA | 9304 | p.Gly668Asp | missense_variant | 1.0 | levofloxacin | Not assoc w R |
| moxifloxacin | Not assoc w R | |||||
| rpoB | 761407 | p.Val534Ala | missense_variant | 1.0 | rifampicin | Uncertain significance |
| rpoB | 761889 | p.Val695Leu | missense_variant | 1.0 | rifampicin | Uncertain significance |
| mmpL5 | 775639 | p.Ile948Val | missense_variant | 1.0 | bedaquiline | Not assoc w R - Interim |
| clofazimine | Not assoc w R | |||||
| rpsL | 781395 | c.-165T>C | upstream_gene_variant | 1.0 | streptomycin | Not assoc w R |
| rplC | 801009 | c.201A>G | synonymous_variant | 1.0 | linezolid | Not assoc w R - Interim |
| rrs | 1471659 | n.-187C>T | upstream_gene_variant | 1.0 | kanamycin | |
| capreomycin | ||||||
| streptomycin | ||||||
| amikacin | ||||||
| tsnR | 1854300 | p.Leu232Pro | missense_variant | 1.0 | linezolid | Not assoc w R |
| tlyA | 1917972 | c.33A>G | synonymous_variant | 1.0 | capreomycin | Not assoc w R |
| tlyA | 1918739 | p.Gly267Asp | missense_variant | 1.0 | capreomycin | |
| Rv1979c | 2223214 | c.-50A>C | upstream_gene_variant | 1.0 | bedaquiline | Uncertain significance |
| clofazimine | Uncertain significance | |||||
| Rv1979c | 2223293 | c.-129A>G | upstream_gene_variant | 1.0 | bedaquiline | Not assoc w R - Interim |
| clofazimine | Not assoc w R | |||||
| Rv2752c | 3065517 | c.675C>T | synonymous_variant | 1.0 | levofloxacin | Not assoc w R - Interim |
| moxifloxacin | Not assoc w R - Interim | |||||
| isoniazid | Not assoc w R - Interim | |||||
| rifampicin | Not assoc w R - Interim | |||||
| ethambutol | Not assoc w R - Interim | |||||
| thyA | 3074086 | p.Ile129Thr | missense_variant | 1.0 | para-aminosalicylic_acid | |
| thyA | 3074494 | c.-80_-24delCGCTGGGTTTGTTTGGCGGCGAGTCGCTGCGGCGGCTTCGCCGCGCTTGCGATCGCC | upstream_gene_variant | 1.0 | para-aminosalicylic_acid | |
| thyA | 3074494 | c.-80_-24delCGCTGGGTTTGTTTGGCGGCGAGTCGCTGCGGCGGCTTCGCCGCGCTTGCGATCGCC | upstream_gene_variant | 1.0 | para-aminosalicylic_acid | |
| Rv3083 | 3448439 | c.-64delA | upstream_gene_variant | 1.0 | ethionamide | |
| rpoA | 3878595 | c.-88C>T | upstream_gene_variant | 0.42 | rifampicin | |
| embC | 4242643 | c.2781C>T | synonymous_variant | 0.99 | ethambutol | Not assoc w R |
| ethA | 4328317 | c.-844C>T | upstream_gene_variant | 1.0 | ethionamide | |
| whiB6 | 4338595 | c.-75delG | upstream_gene_variant | 1.0 | kanamycin | Not assoc w R |
| capreomycin | Not assoc w R | |||||
| amikacin | Not assoc w R | |||||
| whiB6 | 4338732 | c.-211C>T | upstream_gene_variant | 1.0 | kanamycin | |
| capreomycin | ||||||
| amikacin |