TB-Profiler result

Run: ERR4818772

Summary

Run ID: ERR4818772

Sample name:

Date: 2024-04-14T02:31:26.025702

Number of reads: 3188342

Percentage reads mapped: 97.84

Median coverage: 71.0

Strain: lineage4.6

Spoligotype:

Drug-resistance: Sensitive


Download CSV Download TXT Download JSON
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family RDs Frequency
lineage4.6 Euro-American None 1.0
lineage4 Euro-American None 1.0
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations WHO confidence Comment
rifampicin
isoniazid
ethambutol
pyrazinamide
streptomycin
fluoroquinolones
moxifloxacin
ofloxacin
levofloxacin
ciprofloxacin
aminoglycosides
amikacin
capreomycin
kanamycin
cycloserine
ethionamide
clofazimine
para-aminosalicylic_acid
delamanid
bedaquiline
linezolid
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence Comment
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence
gyrA 7362 p.Glu21Gln missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 7585 p.Ser95Thr missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 8266 p.Ala322Glu missense_variant 1.0 levofloxacin Uncertain significance
moxifloxacin Uncertain significance
gyrA 9304 p.Gly668Asp missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
fgd1 491349 c.567T>C synonymous_variant 1.0 clofazimine Not assoc w R - Interim
pretomanid
delamanid Not assoc w R - Interim
rpoC 766586 p.Glu1073Lys missense_variant 0.99 rifampicin Uncertain significance
mmpL5 775639 p.Ile948Val missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
mmpL5 775822 p.Val887Met missense_variant 1.0 clofazimine
bedaquiline
rpsL 781395 c.-165T>C upstream_gene_variant 1.0 streptomycin Not assoc w R
fbiC 1303098 c.168C>A synonymous_variant 1.0 clofazimine
pretomanid
delamanid
rrs 1471659 n.-187C>T upstream_gene_variant 1.0 streptomycin
kanamycin
capreomycin
amikacin
rrs 1473318 n.1473G>A non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrl 1476428 n.2771C>T non_coding_transcript_exon_variant 0.38 capreomycin Not assoc w R
linezolid Uncertain significance
tsnR 1854300 p.Leu232Pro missense_variant 1.0 linezolid Not assoc w R
tlyA 1917972 c.33A>G synonymous_variant 1.0 capreomycin Not assoc w R
katG 2156267 c.-156A>C upstream_gene_variant 1.0 isoniazid Uncertain significance
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
Rv2477c 2784050 c.-8A>G upstream_gene_variant 0.98 ethambutol Uncertain significance
moxifloxacin Uncertain significance
streptomycin Uncertain significance
levofloxacin Uncertain significance
kanamycin Uncertain significance
rifampicin Uncertain significance
amikacin Uncertain significance
Rv2477c 2784217 c.-212_-176delNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNC upstream_gene_variant 1.0 ethambutol
moxifloxacin
streptomycin
levofloxacin
kanamycin
rifampicin
amikacin
Rv2477c 2784217 c.-211_-176delATCTCCCGGCCGCCACGGGGACCGGGGCGGCCGGTG upstream_gene_variant 1.0 ethambutol
moxifloxacin
streptomycin
levofloxacin
kanamycin
rifampicin
amikacin
embC 4242643 c.2781C>T synonymous_variant 1.0 ethambutol Not assoc w R
ethA 4328462 c.-989C>A upstream_gene_variant 1.0 ethionamide
whiB6 4338595 c.-75delG upstream_gene_variant 1.0 capreomycin Not assoc w R
amikacin Not assoc w R
kanamycin Not assoc w R
whiB6 4338732 c.-211C>T upstream_gene_variant 1.0 capreomycin
amikacin
kanamycin
gid 4407554 p.Arg217Trp missense_variant 1.0 streptomycin Uncertain significance