TB-Profiler result

Run: ERR9806659

Summary

Run ID: ERR9806659

Sample name:

Date: 21-05-2023 00:39:01

Number of reads: 4982128

Percentage reads mapped: 99.58

Strain: lineage4.8

Drug-resistance: MDR-TB


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Rifampicin R rpoB p.Ser450Leu (1.00)
Isoniazid R katG p.Ser315Thr (1.00)
Ethambutol R embB p.Met306Val (0.99)
Pyrazinamide R pncA p.Met175Val (0.98)
Streptomycin R rpsL p.Lys43Arg (1.00)
Fluoroquinolones
Moxifloxacin
Ofloxacin
Levofloxacin
Ciprofloxacin
Aminoglycosides
Amikacin
Capreomycin
Kanamycin
Cycloserine
Ethionamide R ethA c.867_934delGGACCAGCGATTGTGCTTGGTGCCCAACGGCGACCTGTTCCGGGCCATTCGTCACGGGAAGGTCGAGG (1.00)
Clofazimine
Para-aminosalicylic_acid
Delamanid
Bedaquiline
Linezolid
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.8 Euro-American (mainly T) T1;T2;T3;T5 RD219 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
rpoB 761155 p.Ser450Leu missense_variant 1.0 rifampicin
rpsL 781687 p.Lys43Arg missense_variant 1.0 streptomycin
katG 2155168 p.Ser315Thr missense_variant 1.0 isoniazid
pncA 2288719 p.Met175Val missense_variant 0.98 pyrazinamide
embB 4247429 p.Met306Val missense_variant 0.99 ethambutol
ethA 4326539 c.867_934delGGACCAGCGATTGTGCTTGGTGCCCAACGGCGACCTGTTCCGGGCCATTCGTCACGGGAAGGTCGAGG frameshift_variant 1.0 ethionamide
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
rpoC 765862 p.Phe831Leu missense_variant 0.99
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrl 1474001 n.344C>T non_coding_transcript_exon_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
PPE35 2168149 p.Pro822Ser missense_variant 0.99
PPE35 2169149 c.1464G>C synonymous_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
pncA 2288949 p.Ala98Val missense_variant 1.0
Rv3083 3448497 c.-7T>A upstream_gene_variant 1.0
rpoA 3878641 c.-135delG upstream_gene_variant 0.12
clpC1 4039729 p.Asp326Asn missense_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0