TB-Profiler result

Run: SRR10306017

Summary

Run ID: SRR10306017

Sample name:

Date: 02-04-2023 17:05:03

Number of reads: 3096661

Percentage reads mapped: 99.19

Strain: lineage4.5

Drug-resistance: MDR-TB


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.5 Euro-American H;T RD122 0.99
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
rpoB 761155 p.Ser450Leu missense_variant 1.0 rifampicin
katG 2155168 p.Ser315Thr missense_variant 1.0 isoniazid
pncA 2289192 p.Gly17Asp missense_variant 0.99 pyrazinamide
embB 4247574 p.Asp354Ala missense_variant 1.0 ethambutol
gid 4408100 c.102delG frameshift_variant 1.0 streptomycin
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 7892 c.591G>A synonymous_variant 0.98
gyrA 9304 p.Gly668Asp missense_variant 1.0
ccsA 620029 c.139C>T synonymous_variant 1.0
rpoC 765609 p.Asp747Gly missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpR5 778244 c.-746G>A upstream_gene_variant 0.98
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.23
Rv1258c 1406101 p.Pro414Ser missense_variant 0.98
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
PPE35 2170568 p.Ile15Met missense_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
fbiA 3640346 c.-196delA upstream_gene_variant 0.99
rpoA 3878575 c.-68C>T upstream_gene_variant 1.0
clpC1 4038318 p.Pro796Leu missense_variant 0.99
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embA 4243204 c.-28delT upstream_gene_variant 0.99
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0