TB-Profiler result

Run: SRR13591425
Summary

Run ID: SRR13591425

Sample name:

Date: 03-04-2023 09:07:03

Number of reads: 1247812

Percentage reads mapped: 99.45

Strain: lineage4.3.4.2

Drug-resistance: Other

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.3 Euro-American (LAM) mainly-LAM None 0.99
lineage4.3.4 Euro-American (LAM) LAM RD174 0.99
lineage4.3.4.2 Euro-American (LAM) LAM1;LAM4;LAM11 RD174 0.99
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
rpsL 781687 p.Lys43Arg missense_variant 1.0 streptomycin
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 6817 c.-485G>A upstream_gene_variant 1.0
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 0.98
gyrA 9304 p.Gly668Asp missense_variant 1.0
rpoC 764995 c.1626C>G synonymous_variant 0.99
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.75
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrl 1475780 n.2123A>G non_coding_transcript_exon_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 0.99
thyA 3073868 p.Thr202Ala missense_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
Rv3236c 3612009 p.Ala370Thr missense_variant 1.0
alr 3840565 p.Ser286Pro missense_variant 1.0
rpoA 3878030 p.Gly160Arg missense_variant 0.3
rpoA 3878578 c.-71C>A upstream_gene_variant 0.67
clpC1 4038287 c.2418C>T synonymous_variant 1.0
embC 4239763 c.-100C>T upstream_gene_variant 1.0
embC 4241419 c.1557C>T synonymous_variant 0.96
embA 4242643 c.-590C>T upstream_gene_variant 1.0
whiB6 4338593 c.-73delT upstream_gene_variant 1.0
whiB6 4338596 c.-75G>C upstream_gene_variant 1.0
gid 4408156 p.Leu16Arg missense_variant 0.98
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0