TB-Profiler result

Run: SRR15364434
Summary

Run ID: SRR15364434

Sample name:

Date: 03-04-2023 13:43:14

Number of reads: 2195467

Percentage reads mapped: 98.9

Strain: lineage4.9

Drug-resistance: Pre-XDR-TB

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.9 Euro-American (H37Rv-like) T1 None 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
gyrB 6620 p.Asp461His missense_variant 0.99 ofloxacin, moxifloxacin, levofloxacin, fluoroquinolones, ciprofloxacin
rpoB 761101 p.Gln432Pro missense_variant 1.0 rifampicin
katG 2155168 p.Ser315Thr missense_variant 1.0 isoniazid
pncA 2288818 c.392_423delTCGGTATTGCCACCGATCATTGTGTGCGCCAG frameshift_variant 1.0 pyrazinamide
ahpC 2726141 c.-52C>T upstream_gene_variant 0.98 isoniazid
gid 4407830 p.Gln125* stop_gained 1.0 streptomycin
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7381 p.Ser27Thr missense_variant 0.99
rplC 801355 p.His183Tyr missense_variant 1.0
embR 1417263 p.Pro29Thr missense_variant 0.98
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
ahpC 2726109 c.-84T>C upstream_gene_variant 1.0
embB 4248465 p.Ser651Asn missense_variant 1.0
ethA 4326288 p.Asp396Tyr missense_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
pncA 2288818 c.391_423delNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNA conservative_inframe_deletion 1.0