TB-Profiler result

Run: SRR16058108

Summary

Run ID: SRR16058108

Sample name:

Date: 03-04-2023 15:23:39

Number of reads: 1564671

Percentage reads mapped: 99.45

Strain: lineage4.6

Drug-resistance: Sensitive


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.6 Euro-American T;LAM None 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7102 c.-200G>A upstream_gene_variant 1.0
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 0.99
rpoC 763644 p.Met92Thr missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
PPE35 2168080 p.Thr845Ala missense_variant 1.0
PPE35 2168813 c.1722_1799delAGCGCTAGGTGCGTTCAATCTGCCGACGCTGAGTATTCCGTCGGTGACGGTTCCGCCGATCACGATTCCGGCTGGCAC disruptive_inframe_deletion 1.0
PPE35 2170198 p.Ala139Thr missense_variant 1.0
PPE35 2170792 c.-180T>C upstream_gene_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
pepQ 2860360 p.Asp20Gly missense_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
aftB 4267815 p.Ala341Val missense_variant 0.12
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
PPE35 2168813 c.1721_1799delNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNC frameshift_variant 1.0