TB-Profiler result

Run: SRR16096975

Summary

Run ID: SRR16096975

Sample name:

Date: 03-04-2023 16:15:26

Number of reads: 2359281

Percentage reads mapped: 99.71

Strain: lineage4

Drug-resistance: Sensitive


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
fgd1 490640 c.-143C>G upstream_gene_variant 1.0
rpoB 761889 p.Val695Leu missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpL5 777009 p.Pro491Leu missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rplC 801009 c.201A>G synonymous_variant 1.0
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.33
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
Rv1979c 2223214 c.-50A>C upstream_gene_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
eis 2714907 c.426C>G synonymous_variant 1.0
Rv2752c 3065517 c.675C>T synonymous_variant 1.0
fprA 3474299 p.Asp98Gly missense_variant 1.0
whiB7 3568418 c.250_261delGGACGTCCGCGC conservative_inframe_deletion 1.0
embA 4242643 c.-590C>T upstream_gene_variant 0.99
ethA 4328317 c.-844C>T upstream_gene_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4407996 c.207T>C synonymous_variant 1.0
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0