TB-Profiler result

Run: SRR2101496
Summary

Run ID: SRR2101496

Sample name:

Date: 03-04-2023 23:45:09

Number of reads: 480517

Percentage reads mapped: 98.7

Strain: lineage3

Drug-resistance: Sensitive

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage3 East-African-Indian CAS RD750 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7538 p.Glu79Asp missense_variant 0.2
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
fgd1 491742 c.960T>C synonymous_variant 1.0
rpoB 759620 c.-187A>C upstream_gene_variant 0.27
rpoB 759746 c.-61C>T upstream_gene_variant 1.0
rpoC 762434 c.-936T>G upstream_gene_variant 1.0
rpoC 763031 c.-339T>C upstream_gene_variant 1.0
rpoB 763230 p.Arg1142Ser missense_variant 0.14
rpoC 766582 c.3213C>A synonymous_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpL5 776100 p.Thr794Ile missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1304550 c.1620C>T synonymous_variant 0.11
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.33
Rv1258c 1407162 p.Leu60Pro missense_variant 0.17
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrs 1473081 n.1236C>A non_coding_transcript_exon_variant 0.13
rrl 1473912 n.255C>G non_coding_transcript_exon_variant 0.2
rrl 1475619 n.1962C>A non_coding_transcript_exon_variant 0.12
tlyA 1917972 c.33A>G synonymous_variant 1.0
ndh 2102012 p.Ala344Asp missense_variant 0.1
katG 2154724 p.Arg463Leu missense_variant 1.0
PPE35 2167926 p.Leu896Ser missense_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
pncA 2289047 c.195C>T synonymous_variant 1.0
pncA 2289365 c.-125delC upstream_gene_variant 1.0
eis 2714569 p.Ala255Gly missense_variant 0.25
ahpC 2726105 c.-88G>A upstream_gene_variant 1.0
ahpC 2726338 p.Val49Gly missense_variant 0.25
thyA 3074086 p.Ile129Thr missense_variant 0.11
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473983 c.-24C>T upstream_gene_variant 0.15
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
alr 3841473 c.-53G>A upstream_gene_variant 1.0
alr 3841559 c.-139C>T upstream_gene_variant 1.0
clpC1 4038858 p.Arg616Pro missense_variant 0.15
clpC1 4040652 p.Glu18Gly missense_variant 0.12
embC 4240466 p.Thr202Ala missense_variant 0.13
embC 4240648 c.786C>T synonymous_variant 0.29
embC 4242075 p.Arg738Gln missense_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embA 4244570 c.1338C>T synonymous_variant 0.2
embA 4245949 c.2718delG frameshift_variant 0.13
embB 4247270 p.Leu253Ile missense_variant 1.0
embB 4249251 p.Ala913Val missense_variant 0.9
ethR 4327852 p.Met102Leu missense_variant 0.15
whiB6 4338365 p.Cys53Arg missense_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4407588 c.615A>G synonymous_variant 1.0
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0