TB-Profiler result

Run: SRR21576641
Summary

Run ID: SRR21576641

Sample name:

Date: 04-04-2023 02:12:08

Number of reads: 1203552

Percentage reads mapped: 98.08

Strain: lineage4.5

Drug-resistance: MDR-TB

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.5 Euro-American H;T RD122 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
rpoB 761155 p.Ser450Trp missense_variant 1.0 rifampicin
rpsL 781687 p.Lys43Arg missense_variant 1.0 streptomycin
katG 2155168 p.Ser315Thr missense_variant 1.0 isoniazid
pncA 2289219 p.Asp8Gly missense_variant 1.0 pyrazinamide
embA 4243217 c.-16C>T upstream_gene_variant 1.0 ethambutol
embB 4247429 p.Met306Val missense_variant 1.0 ethambutol
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 7892 c.591G>A synonymous_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
ccsA 620029 c.139C>T synonymous_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpS5 779636 c.-731C>T upstream_gene_variant 0.99
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rplC 801133 p.Gly109Arg missense_variant 1.0
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.52
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrs 1472151 n.306C>T non_coding_transcript_exon_variant 0.17
rrl 1474748 n.1091T>C non_coding_transcript_exon_variant 0.4
rrl 1474942 n.1285A>G non_coding_transcript_exon_variant 0.4
rrl 1475292 n.1635C>T non_coding_transcript_exon_variant 0.25
rrl 1475921 n.2264A>G non_coding_transcript_exon_variant 0.13
rrl 1475970 n.2313C>G non_coding_transcript_exon_variant 0.1
tlyA 1917972 c.33A>G synonymous_variant 1.0
PPE35 2170048 p.Leu189Val missense_variant 0.14
PPE35 2170053 p.Thr187Ser missense_variant 0.12
PPE35 2170568 p.Ile15Met missense_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
ribD 2986827 c.-12G>A upstream_gene_variant 1.0
Rv2752c 3064684 p.Ala503Glu missense_variant 1.0
ald 3087081 p.Gly88Trp missense_variant 0.12
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
whiB7 3568734 c.-55G>A upstream_gene_variant 1.0
fbiA 3640386 c.-157A>G upstream_gene_variant 1.0
fbiA 3640387 c.-156G>A upstream_gene_variant 1.0
alr 3841356 p.Ser22Leu missense_variant 1.0
rpoA 3878575 c.-68C>T upstream_gene_variant 1.0
clpC1 4038318 p.Pro796Leu missense_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embB 4246544 p.Thr11Pro missense_variant 0.1
embB 4246555 c.42G>C synonymous_variant 0.1
embB 4246556 p.Ala15Pro missense_variant 0.1
ethA 4326854 p.Arg207His missense_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0