TB-Profiler result

Run: SRR22250098

Summary

Run ID: SRR22250098

Sample name:

Date: 2024-03-27T02:47:09.974964

Number of reads: 26777715

Percentage reads mapped: 99.61

Median coverage: 863.0

Strain: lineage4.1.2.1

Spoligotype:

Drug-resistance: RR-TB


Download CSV Download TXT Download JSON
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family RDs Frequency
lineage4.1 Euro-American None 1.0
lineage4.1.2 Euro-American None 1.0
lineage4.1.2.1 Euro-American (Haarlem) RD182 1.0
lineage4 Euro-American None 1.0
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations WHO confidence Comment
rifampicin rpoB p.Ser450Leu Assoc w R
isoniazid
ethambutol
pyrazinamide
streptomycin
fluoroquinolones
moxifloxacin
ofloxacin
levofloxacin
ciprofloxacin
aminoglycosides
amikacin
capreomycin
kanamycin
cycloserine
ethionamide
clofazimine
para-aminosalicylic_acid
delamanid
bedaquiline
linezolid
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence Comment
rpoB 761155 p.Ser450Leu missense_variant 1.0 rifampicin Assoc w R
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence
gyrA 7362 p.Glu21Gln missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 7585 p.Ser95Thr missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 9304 p.Gly668Asp missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
fgd1 491591 p.Lys270Met missense_variant 1.0 clofazimine Not assoc w R
pretomanid
delamanid Uncertain significance
mshA 575679 p.Asn111Ser missense_variant 1.0 ethionamide Not assoc w R
isoniazid Not assoc w R
mshA 576089 c.750_769delTGATCGGCGCGCGGCCCGGG frameshift_variant 0.24 ethionamide Uncertain significance
isoniazid Uncertain significance
Rv0565c 657269 p.Ser68Pro missense_variant 1.0 ethionamide Uncertain significance
rpoB 760115 c.309C>T synonymous_variant 1.0 rifampicin Not assoc w R
rpoC 765150 p.Gly594Glu missense_variant 1.0 rifampicin Not assoc w R
mmpL5 775639 p.Ile948Val missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
rpsL 781395 c.-165T>C upstream_gene_variant 1.0 streptomycin Not assoc w R
rrs 1471659 n.-187C>T upstream_gene_variant 1.0 streptomycin
kanamycin
capreomycin
amikacin
tsnR 1854300 p.Leu232Pro missense_variant 1.0 linezolid Not assoc w R
tlyA 1917972 c.33A>G synonymous_variant 1.0 capreomycin Not assoc w R
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
kasA 2518076 c.-39C>T upstream_gene_variant 1.0 isoniazid
Rv2680 2996034 c.-71G>A upstream_gene_variant 0.17 capreomycin Uncertain significance
Rv2680 2996085 c.-20G>A upstream_gene_variant 0.11 capreomycin Uncertain significance
Rv2680 2996136 p.Ser11Asn missense_variant 0.14 capreomycin
ald 3086788 c.-32T>C upstream_gene_variant 1.0 cycloserine
fbiD 3339040 c.-78T>C upstream_gene_variant 1.0 clofazimine
pretomanid
delamanid
mtrB 3625065 p.Met517Leu missense_variant 1.0 bedaquiline Uncertain significance
rifampicin Not assoc w R
mtrA 3627756 c.-407A>T upstream_gene_variant 1.0 bedaquiline
rifampicin
embC 4239298 c.-565C>T upstream_gene_variant 1.0 ethambutol Not assoc w R
embC 4242643 c.2781C>T synonymous_variant 1.0 ethambutol Not assoc w R
embC 4242803 p.Val981Leu missense_variant 1.0 ethambutol Not assoc w R
embB 4248043 c.1530C>G synonymous_variant 1.0 ethambutol Not assoc w R - Interim
whiB6 4338595 c.-75delG upstream_gene_variant 1.0 capreomycin Not assoc w R
amikacin Not assoc w R
kanamycin Not assoc w R
whiB6 4338732 c.-211C>T upstream_gene_variant 1.0 capreomycin
amikacin
kanamycin
whiB6 4338901 c.-380T>G upstream_gene_variant 1.0 capreomycin
amikacin
kanamycin
gid 4408312 c.-110C>T upstream_gene_variant 1.0 streptomycin