TB-Profiler result

Run: SRR6824338

Summary

Run ID: SRR6824338

Sample name:

Date: 2024-03-25T19:46:21.665786

Number of reads: 9083342

Percentage reads mapped: 99.35

Median coverage: 262.0

Strain: lineage4.2.2

Spoligotype:

Drug-resistance: RR-TB


Download CSV Download TXT Download JSON
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family RDs Frequency
lineage4.2.2 Euro-American (Ural) None 1.0
lineage4.2 Euro-American None 1.0
lineage4 Euro-American None 1.0
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations WHO confidence Comment
rifampicin rpoB p.Gln432Lys Assoc w R
isoniazid
ethambutol
pyrazinamide
streptomycin
fluoroquinolones
moxifloxacin
ofloxacin
levofloxacin
ciprofloxacin
aminoglycosides
amikacin
capreomycin
kanamycin
cycloserine
ethionamide
clofazimine
para-aminosalicylic_acid
delamanid
bedaquiline
linezolid
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence Comment
rpoB 761100 p.Gln432Lys missense_variant 1.0 rifampicin Assoc w R
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence
gyrA 7362 p.Glu21Gln missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 7585 p.Ser95Thr missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 9304 p.Gly668Asp missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
mshA 576077 c.730C>T synonymous_variant 1.0 ethionamide Not assoc w R - Interim
isoniazid Not assoc w R
rpoB 759940 p.Pro45Gln missense_variant 1.0 rifampicin Uncertain significance
mmpL5 775639 p.Ile948Val missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
rpsL 781395 c.-165T>C upstream_gene_variant 1.0 streptomycin Not assoc w R
rplC 800204 c.-605T>C upstream_gene_variant 1.0 linezolid
rrs 1471659 n.-187C>T upstream_gene_variant 1.0 streptomycin
kanamycin
capreomycin
amikacin
tsnR 1854300 p.Leu232Pro missense_variant 1.0 linezolid Not assoc w R
tlyA 1917972 c.33A>G synonymous_variant 1.0 capreomycin Not assoc w R
bacA 2063685 c.1044G>A synonymous_variant 1.0 streptomycin Not assoc w R - Interim
kanamycin Not assoc w R - Interim
capreomycin Not assoc w R
amikacin Not assoc w R
bacA 2063911 p.Ile273Thr missense_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
katG 2155216 p.Gly299Val missense_variant 1.0 isoniazid
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
Rv1979c 2223770 c.-670_-607delNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG upstream_gene_variant 1.0 clofazimine
bedaquiline
Rv1979c 2223770 c.-669_-607delTGGAAAATTACATCGCCCAGACGCGCGACAAGTTCCTCAGCGCGGCCACATCGTCCACTCCAC upstream_gene_variant 1.0 clofazimine
bedaquiline
Rv2752c 3066276 c.-85G>A upstream_gene_variant 0.99 ethambutol
moxifloxacin
levofloxacin
rifampicin
isoniazid
Rv2752c 3066280 c.-89C>T upstream_gene_variant 0.99 ethambutol
moxifloxacin
levofloxacin
rifampicin
isoniazid
ald 3086742 c.-78A>C upstream_gene_variant 1.0 cycloserine
ald 3086788 c.-32T>C upstream_gene_variant 1.0 cycloserine
ald 3087067 p.Gly83Val missense_variant 1.0 cycloserine
Rv3236c 3612469 c.648A>G synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
mtrB 3625065 p.Met517Leu missense_variant 1.0 bedaquiline Uncertain significance
rifampicin Not assoc w R
glpK 4138427 c.1329G>A synonymous_variant 1.0 ethambutol Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
streptomycin Not assoc w R - Interim
levofloxacin Not assoc w R - Interim
rifampicin Not assoc w R - Interim
isoniazid Not assoc w R - Interim
embC 4242643 c.2781C>T synonymous_variant 1.0 ethambutol Not assoc w R
whiB6 4338595 c.-75delG upstream_gene_variant 1.0 capreomycin Not assoc w R
amikacin Not assoc w R
kanamycin Not assoc w R
whiB6 4338732 c.-211C>T upstream_gene_variant 1.0 capreomycin
amikacin
kanamycin