TB-Profiler result

Run: SRR6824360


Run ID: SRR6824360

Sample name:

Date: 20-10-2023 19:46:27

Number of reads: 9961620

Percentage reads mapped: 99.43

Strain: lineage4.5

Drug-resistance: MDR-TB

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Rifampicin R rpoB p.Ser450Gln (1.00)
Isoniazid R katG c.98_126delGCGGAAACCAGGACTGGTGGCCCAACCGG (0.99), ahpC c.-52C>T (1.00)
Ethambutol R embB p.Met306Val (1.00)
Streptomycin R rpsL p.Lys43Arg (1.00)
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.5 Euro-American H;T RD122 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
rpoB 761154 p.Ser450Gln missense_variant 1.0 rifampicin
rpsL 781687 p.Lys43Arg missense_variant 1.0 streptomycin
katG 2155985 c.98_126delGCGGAAACCAGGACTGGTGGCCCAACCGG frameshift_variant 0.99 isoniazid
ahpC 2726141 c.-52C>T upstream_gene_variant 1.0 isoniazid
embB 4247429 p.Met306Val missense_variant 1.0 ethambutol
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 7892 c.591G>A synonymous_variant 0.99
gyrA 9304 p.Gly668Asp missense_variant 1.0
ccsA 620029 c.139C>T synonymous_variant 1.0
rpoB 761559 p.Thr585Ala missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1304986 p.Pro686Thr missense_variant 1.0
Rv1258c 1406481 p.Arg287His missense_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrl 1476704 n.3053dupC non_coding_transcript_exon_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
PPE35 2170568 p.Ile15Met missense_variant 1.0
Rv1979c 2222057 p.Asp370Asn missense_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
eis 2714464 p.Arg290His missense_variant 1.0
eis 2714984 p.Ala117Thr missense_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
rpoA 3878575 c.-68C>T upstream_gene_variant 1.0
clpC1 4038318 p.Pro796Leu missense_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
aftB 4268596 p.Tyr81His missense_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
katG 2155985 c.97_126delNNNNNNNNNNNNNNNNNNNNNNNNNNNNNC conservative_inframe_deletion 1.0