TB-Profiler result

Run: SRR6982556

Summary

Run ID: SRR6982556

Sample name:

Date: 04-04-2023 18:41:07

Number of reads: 622634

Percentage reads mapped: 99.25

Strain: lineage4.1

Drug-resistance: Sensitive


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.1 Euro-American T;X;H None 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 8694 c.1393C>T synonymous_variant 1.0
gyrA 8705 c.1404C>T synonymous_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
mshA 576089 c.750_769delTGATCGGCGCGCGGCCCGGG frameshift_variant 0.13
mshA 576307 c.960C>A synonymous_variant 0.17
rpoC 765150 p.Gly594Glu missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.33
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rpsA 1834348 c.807T>C synonymous_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
pncA 2288895 c.338_346delGCACGCCAC disruptive_inframe_deletion 0.38
ahpC 2726099 c.-93delG upstream_gene_variant 0.11
pepQ 2859794 p.Asp209Tyr missense_variant 0.11
thyA 3074489 c.-18G>A upstream_gene_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
fprA 3475346 p.Leu447Arg missense_variant 0.94
whiB7 3568779 c.-100T>A upstream_gene_variant 0.11
Rv3236c 3612515 p.Arg201His missense_variant 1.0
Rv3236c 3612913 p.Leu68Phe missense_variant 0.14
ddn 3986951 c.108T>C synonymous_variant 0.13
embC 4241659 c.1797G>A synonymous_variant 0.11
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embC 4242803 p.Val981Leu missense_variant 1.0
embA 4244157 p.Ser309Thr missense_variant 0.12
embA 4244337 p.Leu369Val missense_variant 0.1
embA 4245426 p.Ser732Gly missense_variant 0.11
embB 4249408 c.2895G>A synonymous_variant 1.0
embB 4249439 p.Glu976* stop_gained 0.11
embB 4249805 p.Pro1098Thr missense_variant 0.12
aftB 4268580 p.Leu86Pro missense_variant 0.2
aftB 4268776 c.60delG frameshift_variant 0.11
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4408031 p.Leu58Phe missense_variant 1.0
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0