TB-Profiler result

Run: SRR7517804

Summary

Run ID: SRR7517804

Sample name:

Date: 14-08-2022 14:16:39

Number of reads: 3909815

Percentage reads mapped: 99.74

Strain: lineage4.3.3

Drug-resistance: MDR-TB


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.3 Euro-American (LAM) mainly-LAM None 1.0
lineage4.3.3 Euro-American (LAM) LAM;T RD115 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
rpoB 761140 p.His445Leu missense_variant 1.0 rifampicin
rrs 1472359 n.514A>C non_coding_transcript_exon_variant 1.0 streptomycin
fabG1 1673425 c.-15C>T upstream_gene_variant 1.0 isoniazid, ethionamide
tlyA 1918040 c.102_121delCGACGGGCTGCCGGCGGTCA frameshift_variant 1.0 capreomycin
katG 2155168 p.Ser315Thr missense_variant 1.0 isoniazid
embB 4247429 p.Met306Val missense_variant 1.0 ethambutol
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 7786 p.Glu162Ala missense_variant 1.0
gyrA 8040 p.Gly247Ser missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
rpoC 764995 c.1626C>G synonymous_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1303095 c.165G>A synonymous_variant 1.0
fbiC 1304962 p.Trp678Gly missense_variant 0.98
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rpsA 1834836 p.Met432Thr missense_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
katG 2156196 c.-85C>T upstream_gene_variant 1.0
PPE35 2170048 p.Leu189Val missense_variant 0.17
PPE35 2170053 p.Thr187Ser missense_variant 0.15
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
kasA 2518919 p.Gly269Ser missense_variant 1.0
folC 2746340 p.Ala420Val missense_variant 1.0
ribD 2986827 c.-12G>A upstream_gene_variant 1.0
thyA 3073868 p.Thr202Ala missense_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
rpoA 3878567 c.-60C>G upstream_gene_variant 0.15
clpC1 4038287 c.2418C>T synonymous_variant 1.0
clpC1 4038968 c.1737G>A synonymous_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4408156 p.Leu16Arg missense_variant 1.0