TB-Profiler result

Run: ERR11043802
Summary

Run ID: ERR11043802

Sample name:

Date: 31-03-2023 11:41:21

Number of reads: 712822

Percentage reads mapped: 99.73

Strain: lineage4.7

Drug-resistance: MDR-TB

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.7 Euro-American (mainly T) T1;T5 None 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
rpoB 761109 p.Asp435Tyr missense_variant 1.0 rifampicin
katG 2155168 p.Ser315Thr missense_variant 1.0 isoniazid
pncA 2288844 p.Ile133Thr missense_variant 1.0 pyrazinamide
embA 4243221 c.-12C>T upstream_gene_variant 1.0 ethambutol
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
rpoB 761827 p.His674Arg missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.42
Rv1258c 1407432 c.-92T>C upstream_gene_variant 0.15
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrl 1474294 n.637C>G non_coding_transcript_exon_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
PPE35 2170675 c.-63G>C upstream_gene_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
whiB7 3568484 p.Trp66Arg missense_variant 0.13
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embB 4249732 c.3219C>G synonymous_variant 1.0
aftB 4267680 p.Ser386* stop_gained 0.12
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4408099 p.Leu35Pro missense_variant 1.0
gid 4408262 c.-60A>C upstream_gene_variant 1.0
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0