TB-Profiler result

Run: ERR2864232

Summary

Run ID: ERR2864232

Sample name:

Date: 2024-10-05T01:47:35.221548

Number of reads: 3077321

Percentage reads mapped: 99.5

Median coverage: 112.0

Strain: lineage3

Spoligotype:

Drug-resistance: MDR-TB


Download CSV Download TXT Download JSON
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family RDs Frequency
lineage3 East-African-Indian RD750 1.0
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations WHO confidence Comment
rifampicin rpoB p.Ser450Leu Assoc w R
isoniazid katG p.Ser315Thr Assoc w R High-level resistance
ethambutol
pyrazinamide
streptomycin rpsL p.Lys43Arg Assoc w R
fluoroquinolones
moxifloxacin
ofloxacin
levofloxacin
ciprofloxacin
aminoglycosides
amikacin
capreomycin
kanamycin
cycloserine
ethionamide
clofazimine
para-aminosalicylic_acid
delamanid
bedaquiline
linezolid
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence Comment
rpoB 761155 p.Ser450Leu missense_variant 1.0 rifampicin Assoc w R
rpsL 781687 p.Lys43Arg missense_variant 1.0 streptomycin Assoc w R
katG 2155168 p.Ser315Thr missense_variant 1.0 isoniazid Assoc w R High-level resistance
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence
gyrA 7362 p.Glu21Gln missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 7585 p.Ser95Thr missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 9304 p.Gly668Asp missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
fgd1 491742 c.960T>C synonymous_variant 1.0 pretomanid
delamanid Not assoc w R - Interim
clofazimine Not assoc w R
Rv0565c 657081 c.390G>A synonymous_variant 1.0 ethionamide Not assoc w R - Interim
rpoB 759746 c.-61C>T upstream_gene_variant 1.0 rifampicin Not assoc w R
rpoB 762434 c.2628T>G synonymous_variant 1.0 rifampicin Not assoc w R
rpoB 763031 c.3225T>C synonymous_variant 1.0 rifampicin Not assoc w R
mmpL5 775639 p.Ile948Val missense_variant 1.0 bedaquiline Not assoc w R - Interim
clofazimine Not assoc w R
mmpL5 776100 p.Thr794Ile missense_variant 1.0 bedaquiline Not assoc w R - Interim
clofazimine Not assoc w R
rpsL 781395 c.-165T>C upstream_gene_variant 0.99 streptomycin Not assoc w R
Rv1129c 1254562 c.-28T>C upstream_gene_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
isoniazid Not assoc w R
rifampicin Not assoc w R
rrs 1471659 n.-187C>T upstream_gene_variant 1.0 kanamycin
capreomycin
streptomycin
amikacin
rrl 1474546 n.889G>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid
tsnR 1854300 p.Leu232Pro missense_variant 1.0 linezolid Not assoc w R
tlyA 1917972 c.33A>G synonymous_variant 1.0 capreomycin Not assoc w R
katG 2154724 p.Arg463Leu missense_variant 1.0 isoniazid Not assoc w R
PPE35 2167926 p.Leu896Ser missense_variant 1.0 pyrazinamide Not assoc w R
PPE35 2169528 p.Leu362Pro missense_variant 1.0 pyrazinamide Uncertain significance
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0 bedaquiline Not assoc w R - Interim
clofazimine Not assoc w R
pncA 2289047 c.195C>T synonymous_variant 1.0 pyrazinamide Not assoc w R
pncA 2289365 c.-125delC upstream_gene_variant 1.0 pyrazinamide
ahpC 2726105 c.-88G>A upstream_gene_variant 1.0 isoniazid Not assoc w R
Rv2477c 2782498 c.1545C>T synonymous_variant 1.0 kanamycin Not assoc w R
levofloxacin Not assoc w R
moxifloxacin Not assoc w R
streptomycin Not assoc w R - Interim
rifampicin Not assoc w R
ethambutol Not assoc w R
amikacin Not assoc w R
ald 3086788 c.-32T>C upstream_gene_variant 1.0 cycloserine
mtrB 3625065 p.Met517Leu missense_variant 1.0 rifampicin Not assoc w R
bedaquiline Uncertain significance
alr 3840225 p.Thr399Ile missense_variant 0.99 cycloserine
panD 4044872 c.-591C>T upstream_gene_variant 1.0 pyrazinamide
glpK 4138622 c.1134C>T synonymous_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
isoniazid Not assoc w R
streptomycin Not assoc w R - Interim
rifampicin Not assoc w R
ethambutol Not assoc w R
embC 4242075 p.Arg738Gln missense_variant 1.0 ethambutol Not assoc w R
embC 4242643 c.2781C>T synonymous_variant 1.0 ethambutol Not assoc w R
ethA 4326542 c.896_931delGCGACCTGTTCCGGGCCATTCGTCACGGGAAGGTCG disruptive_inframe_deletion 1.0 ethionamide Uncertain significance
whiB6 4338595 c.-75delG upstream_gene_variant 1.0 kanamycin Not assoc w R
capreomycin Not assoc w R
amikacin Not assoc w R
whiB6 4338732 c.-211C>T upstream_gene_variant 0.99 kanamycin
capreomycin
amikacin
gid 4407588 c.615A>G synonymous_variant 1.0 streptomycin Not assoc w R