TB-Profiler result

Run: ERR4195238

Summary

Run ID: ERR4195238

Sample name:

Date: 01-04-2023 05:09:37

Number of reads: 1281473

Percentage reads mapped: 99.52

Strain: lineage4.3.4.2

Drug-resistance: Other


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.3 Euro-American (LAM) mainly-LAM None 0.99
lineage4.3.4 Euro-American (LAM) LAM RD174 1.0
lineage4.3.4.2 Euro-American (LAM) LAM1;LAM4;LAM11 RD174 0.99
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
gyrA 7582 p.Asp94Gly missense_variant 0.98 ofloxacin, moxifloxacin, levofloxacin, fluoroquinolones, ciprofloxacin
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 0.98
gyrA 9304 p.Gly668Asp missense_variant 0.99
rpoC 764995 c.1626C>G synonymous_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 0.96
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.4
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
PPE35 2169269 c.1344A>G synonymous_variant 0.13
PPE35 2169272 c.1341C>G synonymous_variant 0.13
PPE35 2169278 c.1335T>C synonymous_variant 0.17
PPE35 2169281 c.1332T>G synonymous_variant 0.18
PPE35 2170048 p.Leu189Val missense_variant 0.22
PPE35 2170053 p.Thr187Ser missense_variant 0.21
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
kasA 2519128 c.1014G>C synonymous_variant 0.12
kasA 2519131 c.1017G>C synonymous_variant 0.12
kasA 2519140 c.1026G>C synonymous_variant 0.2
kasA 2519143 c.1029G>C synonymous_variant 0.2
kasA 2519153 p.Ile347Val missense_variant 0.14
Rv2752c 3065293 p.Val300Ala missense_variant 1.0
thyA 3073868 p.Thr202Ala missense_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
Rv3236c 3612009 p.Ala370Thr missense_variant 1.0
clpC1 4038287 c.2418C>T synonymous_variant 1.0
clpC1 4039038 p.Gly556Val missense_variant 0.11
clpC1 4040144 c.561G>C synonymous_variant 0.15
embC 4239763 c.-100C>T upstream_gene_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embA 4244184 p.Ser318Arg missense_variant 0.11
embA 4245637 p.Pro802Leu missense_variant 1.0
embA 4245972 p.Ile914Phe missense_variant 0.11
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4408156 p.Leu16Arg missense_variant 0.93
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0