TB-Profiler result

Run: ERR4553432


Run ID: ERR4553432

Sample name:

Date: 2024-05-22T10:55:21.902552

Number of reads: 1442916

Percentage reads mapped: 99.57

Median coverage: 48.0



Drug-resistance: HR-TB

Download CSV Download TXT Download JSON
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family RDs Frequency
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations WHO confidence Comment
isoniazid katG p.Ser315Thr Assoc w R High-level resistance
streptomycin gid p.Ser70Asn Assoc w R
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence Comment
katG 2155168 p.Ser315Thr missense_variant 1.0 isoniazid Assoc w R High-level resistance
gid 4407994 p.Ser70Asn missense_variant 1.0 streptomycin Assoc w R
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence
gyrA 7362 p.Glu21Gln missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 7585 p.Ser95Thr missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 9304 p.Gly668Asp missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
fgd1 491742 c.960T>C synonymous_variant 1.0 clofazimine Not assoc w R
delamanid Not assoc w R - Interim
Rv0565c 656546 p.Ile309Val missense_variant 1.0 ethionamide Uncertain significance
Rv0565c 657081 c.390G>A synonymous_variant 1.0 ethionamide Not assoc w R - Interim
rpoB 763031 c.3225T>C synonymous_variant 1.0 rifampicin Not assoc w R
mmpL5 775639 p.Ile948Val missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
mmpL5 776100 p.Thr794Ile missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
rpsL 781395 c.-165T>C upstream_gene_variant 1.0 streptomycin Not assoc w R
rplC 800434 c.-374_-342delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN upstream_gene_variant 1.0 linezolid
rplC 800434 c.-374_-343delGGGGAGCACCGGACCCGGATACGGGCTCGAGT upstream_gene_variant 1.0 linezolid
Rv1129c 1254562 c.-28T>C upstream_gene_variant 1.0 moxifloxacin Not assoc w R
levofloxacin Not assoc w R
rifampicin Not assoc w R
isoniazid Not assoc w R
rrs 1471659 n.-187C>T upstream_gene_variant 1.0 streptomycin
tsnR 1854300 p.Leu232Pro missense_variant 1.0 linezolid Not assoc w R
tlyA 1917972 c.33A>G synonymous_variant 1.0 capreomycin Not assoc w R
katG 2154724 p.Arg463Leu missense_variant 1.0 isoniazid Not assoc w R
PPE35 2167926 p.Leu896Ser missense_variant 1.0 pyrazinamide Not assoc w R
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
Rv2752c 3065226 c.966G>A synonymous_variant 1.0 ethambutol Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
levofloxacin Not assoc w R - Interim
rifampicin Not assoc w R - Interim
isoniazid Not assoc w R - Interim
Rv2752c 3066110 p.Gly28Ser missense_variant 1.0 ethambutol Uncertain significance
moxifloxacin Uncertain significance
levofloxacin Uncertain significance
rifampicin Uncertain significance
isoniazid Uncertain significance
ald 3086788 c.-32T>C upstream_gene_variant 1.0 cycloserine
mtrB 3625065 p.Met517Leu missense_variant 1.0 bedaquiline Uncertain significance
rifampicin Not assoc w R
embC 4242643 c.2781C>T synonymous_variant 1.0 ethambutol Not assoc w R
whiB6 4338595 c.-75delG upstream_gene_variant 1.0 capreomycin Not assoc w R
amikacin Not assoc w R
kanamycin Not assoc w R
whiB6 4338732 c.-211C>T upstream_gene_variant 1.0 capreomycin
gid 4407588 c.615A>G synonymous_variant 1.0 streptomycin Not assoc w R