TB-Profiler result

Run: ERR4819207
Summary

Run ID: ERR4819207

Sample name:

Date: 01-04-2023 15:58:55

Number of reads: 575541

Percentage reads mapped: 99.56

Strain: lineage3

Drug-resistance: Sensitive

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage3 East-African-Indian CAS RD750 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
fgd1 491742 c.960T>C synonymous_variant 1.0
mshA 576751 p.Lys468Asn missense_variant 0.5
rpoB 759746 c.-61C>T upstream_gene_variant 1.0
rpoC 762434 c.-936T>G upstream_gene_variant 1.0
rpoC 763031 c.-339T>C upstream_gene_variant 1.0
rpoC 765459 p.Ile697Thr missense_variant 0.11
rpoC 767177 p.Ile1270Val missense_variant 0.11
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpL5 776100 p.Thr794Ile missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1303016 p.Val29Gly missense_variant 0.25
atpE 1461204 p.Phe54Ile missense_variant 0.11
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rpsA 1833720 p.Glu60Val missense_variant 0.12
tlyA 1917972 c.33A>G synonymous_variant 1.0
katG 2154724 p.Arg463Leu missense_variant 1.0
PPE35 2167745 p.Thr956Arg missense_variant 0.14
PPE35 2167926 p.Leu896Ser missense_variant 1.0
PPE35 2170392 p.Gly74Ala missense_variant 0.25
PPE35 2170400 c.213G>C synonymous_variant 0.29
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
pncA 2289047 c.195C>T synonymous_variant 1.0
pncA 2289365 c.-125delC upstream_gene_variant 1.0
eis 2715555 c.-223G>A upstream_gene_variant 0.22
ahpC 2726105 c.-88G>A upstream_gene_variant 1.0
Rv2752c 3064938 c.1254G>A synonymous_variant 0.18
ald 3086788 c.-32T>C upstream_gene_variant 1.0
ald 3087282 p.Gly155Arg missense_variant 0.14
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
fprA 3474143 p.Trp46Tyr missense_variant 0.15
alr 3841473 c.-53G>A upstream_gene_variant 1.0
rpoA 3878158 c.329_349delTCGTGCCGCCGGCCGGCGTCA disruptive_inframe_deletion 0.17
rpoA 3878182 p.Asp109Gly missense_variant 0.13
embC 4241919 p.Asp686Val missense_variant 0.12
embC 4242075 p.Arg738Gln missense_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embA 4245011 c.1779C>T synonymous_variant 0.11
ethA 4326062 p.Gly471Asp missense_variant 0.11
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4407588 c.615A>G synonymous_variant 1.0