TB-Profiler result

Run: ERR4822304

Summary

Run ID: ERR4822304

Sample name:

Date: 01-04-2023 17:46:15

Number of reads: 3454908

Percentage reads mapped: 99.72

Strain: lineage4.1.2.1

Drug-resistance: MDR-TB


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.1 Euro-American T;X;H None 1.0
lineage4.1.2 Euro-American T;H None 1.0
lineage4.1.2.1 Euro-American (Haarlem) T1;H1 RD182 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
rpoB 761161 p.Leu452Pro missense_variant 1.0 rifampicin
rpsL 781822 p.Lys88Arg missense_variant 1.0 streptomycin
katG 2155168 p.Ser315Thr missense_variant 1.0 isoniazid
pncA 2288676 c.513_*4delGCTGGAGGAGATGCGCACCGCCAGCGTCGAGTTGGTTTGCAGCTCCTGATGGC frameshift_variant&stop_lost&splice_region_variant 1.0 pyrazinamide
embB 4247431 p.Met306Ile missense_variant 1.0 ethambutol
ethA 4326755 p.Trp240* stop_gained 1.0 ethionamide
pncA 2288676 c.512_*4delNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNA frameshift_variant&stop_lost&splice_region_variant 1.0 pyrazinamide
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
fgd1 491591 p.Lys270Met missense_variant 1.0
mshA 575679 p.Asn111Ser missense_variant 1.0
mshA 576108 p.Ala254Gly missense_variant 0.36
rpoB 760115 c.309C>T synonymous_variant 1.0
rpoC 765150 p.Gly594Glu missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
fabG1 1673346 c.-94C>G upstream_gene_variant 0.14
fabG1 1673349 c.-91G>C upstream_gene_variant 0.13
fabG1 1673357 c.-83G>A upstream_gene_variant 0.16
fabG1 1673359 c.-81T>C upstream_gene_variant 0.17
fabG1 1673361 c.-79C>G upstream_gene_variant 0.17
fabG1 1673380 c.-60C>G upstream_gene_variant 0.26
tlyA 1917972 c.33A>G synonymous_variant 1.0
PPE35 2169902 p.Leu237Phe missense_variant 0.15
PPE35 2169910 p.Asn235Tyr missense_variant 0.15
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
kasA 2518076 c.-39C>T upstream_gene_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embC 4242803 p.Val981Leu missense_variant 1.0
embB 4246544 p.Thr11Pro missense_variant 0.26
embB 4246548 p.Pro12Gln missense_variant 0.19
embB 4246555 c.42G>C synonymous_variant 0.3
embB 4246556 p.Ala15Pro missense_variant 0.3
embB 4246563 p.Leu17Trp missense_variant 0.29
embB 4246567 c.54G>T synonymous_variant 0.36
ubiA 4269311 p.Trp175Gly missense_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0