TB-Profiler result

Run: ERR552160
Summary

Run ID: ERR552160

Sample name:

Date: 02-08-2023 08:43:00

Number of reads: NA

Percentage reads mapped: NA

Strain: lineage4.1

Drug-resistance: Sensitive

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.1 Euro-American T;X;H None 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrB 6507 p.Ala423Val missense_variant 1.0
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
gyrA 9656 c.2355C>G synonymous_variant 1.0
ccsA 620314 c.424C>T synonymous_variant 1.0
rpoC 765150 p.Gly594Glu missense_variant 1.0
rpoC 765187 c.1818C>T synonymous_variant 1.0
rpoC 766012 c.2643C>G synonymous_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpS5 778816 c.85_89delCGCAC frameshift_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rpsL 781421 c.-139C>A upstream_gene_variant 1.0
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.43
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
ndh 2102702 p.Ser114Ile missense_variant 1.0
katG 2156007 c.105C>T synonymous_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
eis 2714308 p.Pro342Leu missense_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
fprA 3474109 p.Ala35Thr missense_variant 1.0
alr 3840871 p.Ala184Thr missense_variant 1.0
clpC1 4039382 c.1323C>T synonymous_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embC 4242803 p.Val981Leu missense_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0