TB-Profiler result

Run: SRR1167358

Summary

Run ID: SRR1167358

Sample name:

Date: 03-04-2023 02:23:39

Number of reads: 4305975

Percentage reads mapped: 97.93

Strain: lineage4.1.1

Drug-resistance: MDR-TB


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.1 Euro-American T;X;H None 1.0
lineage4.1.1 Euro-American (X-type) X1;X2;X3 None 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
rpoB 761139 p.His445Asp missense_variant 1.0 rifampicin
katG 2155168 p.Ser315Thr missense_variant 1.0 isoniazid
pncA 2288953 p.Gly97Cys missense_variant 0.99 pyrazinamide
embB 4248002 p.Gln497Lys missense_variant 1.0 ethambutol
gid 4407851 c.351delG frameshift_variant 1.0 streptomycin
ethA 4326326 c.1108_1147delNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNC frameshift_variant 1.0 ethionamide
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
rpoC 765150 p.Gly594Glu missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
ahpC 2726210 c.18T>C synonymous_variant 1.0
pepQ 2859601 c.816_817dupGG frameshift_variant 0.16
ald 3086788 c.-32T>C upstream_gene_variant 0.99
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
fbiA 3641447 p.Thr302Met missense_variant 1.0
rpoA 3877553 p.Glu319Lys missense_variant 1.0
embC 4240897 c.1035C>G synonymous_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embC 4242803 p.Val981Leu missense_variant 1.0
embA 4245577 p.Lys782Met missense_variant 0.13
embA 4245674 c.2445dupG frameshift_variant 0.17
embB 4247822 c.1314_1316dupCGC disruptive_inframe_insertion 0.22
embB 4249408 c.2895G>A synonymous_variant 0.99
aftB 4267782 c.1054dupG frameshift_variant 0.12
ethA 4326326 c.1109_1147delAGGGCATGATGCTTTCCGGCATCCCCAACATGGCCTACA disruptive_inframe_deletion 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0