TB-Profiler result

Run: SRR2101546

Summary

Run ID: SRR2101546

Sample name:

Date: 03-04-2023 23:47:00

Number of reads: 502825

Percentage reads mapped: 99.57

Strain: lineage4.4.1.1.1;lineage3.1.1

Drug-resistance: Sensitive


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage3 East-African-Indian CAS RD750 0.9
lineage4 Euro-American LAM;T;S;X;H None 0.15
lineage4.4 Euro-American S;T None 0.11
lineage3.1 East-African-Indian Non-CAS1-Delhi RD750 0.88
lineage3.1.1 East-African-Indian CAS1-Kili RD750 0.9
lineage4.4.1 Euro-American (S-type) S;T None 0.06
lineage4.4.1.1 Euro-American S;Orphans None 0.09
lineage4.4.1.1.1 Euro-American S;Orphans None 0.09
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
fgd1 490979 p.Asn66Ser missense_variant 0.87
fgd1 491742 c.960T>C synonymous_variant 0.88
ccsA 619831 c.-60T>G upstream_gene_variant 0.29
rpoB 759746 c.-61C>T upstream_gene_variant 0.79
rpoC 762434 c.-936T>G upstream_gene_variant 0.88
rpoC 763031 c.-339T>C upstream_gene_variant 0.81
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpL5 776100 p.Thr794Ile missense_variant 0.9
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.4
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
ndh 2102990 p.Val18Ala missense_variant 0.24
katG 2154724 p.Arg463Leu missense_variant 0.81
PPE35 2167926 p.Leu896Ser missense_variant 0.91
PPE35 2170461 p.Gly51Glu missense_variant 0.84
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
pncA 2289047 c.195C>T synonymous_variant 0.73
pncA 2289365 c.-125delC upstream_gene_variant 0.89
eis 2715419 c.-88delG upstream_gene_variant 0.12
ahpC 2726105 c.-88G>A upstream_gene_variant 0.92
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fbiD 3339514 c.398delG frameshift_variant 0.11
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
clpC1 4039312 p.Glu465Lys missense_variant 0.11
embC 4240172 p.Val104Met missense_variant 0.81
embC 4241562 p.Arg567His missense_variant 0.92
embC 4242075 p.Arg738Gln missense_variant 0.88
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embB 4249323 p.Ala937Glu missense_variant 0.36
aftB 4268976 c.-140G>A upstream_gene_variant 0.12
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4407588 c.615A>G synonymous_variant 0.96
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0