TB-Profiler result

Run: SRR21747033
Summary

Run ID: SRR21747033

Sample name:

Date: 04-04-2023 03:28:24

Number of reads: 1854758

Percentage reads mapped: 99.62

Strain: lineage4.4.2

Drug-resistance: MDR-TB

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.4 Euro-American S;T None 1.0
lineage4.4.2 Euro-American T1;T2 None 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
rpoB 761095 p.Leu430Pro missense_variant 1.0 rifampicin
inhA 1674048 c.-154G>A upstream_gene_variant 1.0 isoniazid, ethionamide
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrs 1473050 n.1206dupT non_coding_transcript_exon_variant 1.0
rpsA 1834168 c.627C>T synonymous_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
katG 2154418 p.Val565Gly missense_variant 0.99
katG 2155080 c.1032G>A synonymous_variant 0.98
PPE35 2168813 c.1722_1799delAGCGCTAGGTGCGTTCAATCTGCCGACGCTGAGTATTCCGTCGGTGACGGTTCCGCCGATCACGATTCCGGCTGGCAC disruptive_inframe_deletion 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
Rv2752c 3066099 p.Met31Ile missense_variant 0.99
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embA 4243190 c.-43G>C upstream_gene_variant 1.0
embB 4246508 c.-6G>A upstream_gene_variant 1.0
aftB 4268928 c.-92C>T upstream_gene_variant 1.0
aftB 4269375 c.-539G>A upstream_gene_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4408004 p.Asp67Asn missense_variant 1.0
PPE35 2168813 c.1721_1799delNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNC frameshift_variant 1.0