TB-Profiler result

Run: SRR24710213

Summary

Run ID: SRR24710213

Sample name:

Date: 2024-10-03T23:10:20.496092

Number of reads: 3838495

Percentage reads mapped: 99.39

Median coverage: 111.0

Strain: lineage2.2.1

Spoligotype:

Drug-resistance: XDR-TB


Download CSV Download TXT Download JSON
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family RDs Frequency
lineage2 East-Asian RD105 1.0
lineage2.2.1 East-Asian (Beijing) RD105;RD207;RD181 1.0
lineage2.2 East-Asian (Beijing) RD105;RD207 1.0
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations WHO confidence Comment
rifampicin rpoB p.Ser450Leu Assoc w R
isoniazid katG p.Ser315Thr Assoc w R High-level resistance
ethambutol embB p.Met306Val Assoc w R
pyrazinamide pncA c.-19_42delCCGAACGTATGGTGGACGTATGCGGGCGTTGATCATCGTCGACGTGCAGAACGACTTCTGC Assoc w R
streptomycin rpsL p.Lys43Arg Assoc w R
fluoroquinolones
moxifloxacin gyrA p.Asp94Asn Assoc w R High-level resistance
ofloxacin
levofloxacin gyrA p.Asp94Asn Assoc w R
ciprofloxacin
aminoglycosides
amikacin rrs n.1401A>G Assoc w R
capreomycin rrs n.1401A>G Assoc w R
kanamycin rrs n.1401A>G Assoc w R
cycloserine
ethionamide
clofazimine
para-aminosalicylic_acid
delamanid
bedaquiline
linezolid rplC p.Cys154Arg Assoc w R
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence Comment
gyrA 7581 p.Asp94Asn missense_variant 1.0 levofloxacin Assoc w R
moxifloxacin Assoc w R High-level resistance
rpoB 761155 p.Ser450Leu missense_variant 1.0 rifampicin Assoc w R
rpsL 781687 p.Lys43Arg missense_variant 1.0 streptomycin Assoc w R
rplC 801268 p.Cys154Arg missense_variant 1.0 linezolid Assoc w R
rrs 1473246 n.1401A>G non_coding_transcript_exon_variant 1.0 amikacin Assoc w R
capreomycin Assoc w R
kanamycin Assoc w R
katG 2155168 p.Ser315Thr missense_variant 1.0 isoniazid Assoc w R High-level resistance
pncA 2289199 c.-19_42delCCGAACGTATGGTGGACGTATGCGGGCGTTGATCATCGTCGACGTGCAGAACGACTTCTGC start_lost&conservative_inframe_deletion 1.0 pyrazinamide Assoc w R
embB 4247429 p.Met306Val missense_variant 1.0 ethambutol Assoc w R
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence
gyrA 7362 p.Glu21Gln missense_variant 0.99 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 7585 p.Ser95Thr missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 9304 p.Gly668Asp missense_variant 0.99 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
fgd1 491742 c.960T>C synonymous_variant 1.0 pretomanid
delamanid Not assoc w R - Interim
clofazimine Not assoc w R
mshA 575907 p.Ala187Val missense_variant 1.0 isoniazid Not assoc w R
ethionamide Not assoc w R
ccsA 620625 p.Ile245Met missense_variant 1.0 kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
Rv0565c 657081 c.390G>A synonymous_variant 1.0 ethionamide Not assoc w R - Interim
Rv0565c 657142 p.Arg110His missense_variant 1.0 ethionamide Uncertain significance
rpoB 761698 p.Asp631Gly missense_variant 1.0 rifampicin Uncertain significance
rpoB 763031 c.3225T>C synonymous_variant 1.0 rifampicin Not assoc w R
rpoC 766645 p.Glu1092Asp missense_variant 1.0 rifampicin Not assoc w R
mmpL5 775639 p.Ile948Val missense_variant 1.0 bedaquiline Not assoc w R - Interim
clofazimine Not assoc w R
mmpL5 776100 p.Thr794Ile missense_variant 1.0 bedaquiline Not assoc w R - Interim
clofazimine Not assoc w R
mmpL5 776182 p.Asp767Asn missense_variant 1.0 bedaquiline Not assoc w R
clofazimine Not assoc w R
mmpS5 779615 c.-710C>G upstream_gene_variant 1.0 bedaquiline
clofazimine
rpsL 781395 c.-165T>C upstream_gene_variant 1.0 streptomycin Not assoc w R
Rv1129c 1254562 c.-28T>C upstream_gene_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
isoniazid Not assoc w R
rifampicin Not assoc w R
sigE 1364706 c.294G>A synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
Rv1258c 1406760 c.580_581insC frameshift_variant 1.0 streptomycin Uncertain significance
pyrazinamide Uncertain significance
isoniazid Uncertain significance
rrs 1471659 n.-187C>T upstream_gene_variant 1.0 kanamycin
capreomycin
streptomycin
amikacin
rpsA 1834177 c.636A>C synonymous_variant 0.99 pyrazinamide Not assoc w R - Interim
tsnR 1854300 p.Leu232Pro missense_variant 1.0 linezolid Not assoc w R
tlyA 1917972 c.33A>G synonymous_variant 1.0 capreomycin Not assoc w R
katG 2154724 p.Arg463Leu missense_variant 1.0 isoniazid Not assoc w R
PPE35 2167926 p.Leu896Ser missense_variant 1.0 pyrazinamide Not assoc w R
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0 bedaquiline Not assoc w R - Interim
clofazimine Not assoc w R
thyA 3073715 p.Pro253Ala missense_variant 1.0 para-aminosalicylic_acid
ald 3086788 c.-32T>C upstream_gene_variant 1.0 cycloserine
Rv3236c 3612813 p.Thr102Ala missense_variant 1.0 pyrazinamide Not assoc w R - Interim
mtrB 3625065 p.Met517Leu missense_variant 1.0 rifampicin Not assoc w R
bedaquiline Uncertain significance
mtrB 3626562 p.Pro18Ser missense_variant 1.0 rifampicin Not assoc w R
bedaquiline Uncertain significance
embC 4242643 c.2781C>T synonymous_variant 1.0 ethambutol Not assoc w R
embA 4243460 c.228C>T synonymous_variant 1.0 ethambutol Not assoc w R
aftB 4267647 p.Asp397Gly missense_variant 1.0 ethambutol Not assoc w R
ethA 4326533 p.Thr314Ile missense_variant 1.0 ethionamide Uncertain significance
ethR 4328030 p.Ala161Gly missense_variant 0.2 ethionamide
whiB6 4338595 c.-75delG upstream_gene_variant 1.0 kanamycin Not assoc w R
capreomycin Not assoc w R
amikacin Not assoc w R
whiB6 4338732 c.-211C>T upstream_gene_variant 1.0 kanamycin
capreomycin
amikacin
gid 4407588 c.615A>G synonymous_variant 1.0 streptomycin Not assoc w R
gid 4407927 p.Glu92Asp missense_variant 0.99 streptomycin Not assoc w R