TB-Profiler result

Run: SRR28170768


Run ID: SRR28170768

Sample name:

Date: 2024-03-26T13:07:21.488829

Number of reads: 2143270

Percentage reads mapped: 99.07

Median coverage: 123.0

Strain: lineage3


Drug-resistance: Other

Download CSV Download TXT Download JSON
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family RDs Frequency
lineage3 East-African-Indian RD750 0.99
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations WHO confidence Comment
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence Comment
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.4 delamanid Assoc w R - Interim Confers DLM-PMD cross-resistance
pretomanid Assoc w R - Interim Confers DLM-PMD cross-resistance
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence
gyrA 7362 p.Glu21Gln missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 7585 p.Ser95Thr missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 9304 p.Gly668Asp missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
fgd1 491742 c.960T>C synonymous_variant 0.99 clofazimine Not assoc w R
delamanid Not assoc w R - Interim
Rv0565c 657081 c.390G>A synonymous_variant 1.0 ethionamide Not assoc w R - Interim
rpoB 759746 c.-61C>T upstream_gene_variant 0.99 rifampicin Not assoc w R
rpoB 762434 c.2628T>G synonymous_variant 1.0 rifampicin Not assoc w R
rpoB 763031 c.3225T>C synonymous_variant 1.0 rifampicin Not assoc w R
mmpL5 775639 p.Ile948Val missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
mmpL5 776100 p.Thr794Ile missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
mmpL5 777820 c.661C>T synonymous_variant 1.0 clofazimine Not assoc w R - Interim
bedaquiline Not assoc w R - Interim
rpsL 781395 c.-165T>C upstream_gene_variant 1.0 streptomycin Not assoc w R
Rv1129c 1254562 c.-28T>C upstream_gene_variant 1.0 moxifloxacin Not assoc w R
levofloxacin Not assoc w R
rifampicin Not assoc w R
isoniazid Not assoc w R
atpE 1461285 p.Lys81Glu missense_variant 0.13 bedaquiline
rrs 1471659 n.-187C>T upstream_gene_variant 1.0 streptomycin
tsnR 1854300 p.Leu232Pro missense_variant 1.0 linezolid Not assoc w R
tlyA 1917972 c.33A>G synonymous_variant 1.0 capreomycin Not assoc w R
katG 2154724 p.Arg463Leu missense_variant 1.0 isoniazid Not assoc w R
PPE35 2167926 p.Leu896Ser missense_variant 1.0 pyrazinamide Not assoc w R
PPE35 2168651 p.Leu654Phe missense_variant 1.0 pyrazinamide Uncertain significance
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
pncA 2289047 c.195C>T synonymous_variant 1.0 pyrazinamide Not assoc w R
pncA 2289365 c.-125delC upstream_gene_variant 1.0 pyrazinamide
ahpC 2726105 c.-88G>A upstream_gene_variant 1.0 isoniazid Not assoc w R
Rv2477c 2782498 c.1545C>T synonymous_variant 0.99 ethambutol Not assoc w R
moxifloxacin Not assoc w R
streptomycin Not assoc w R - Interim
levofloxacin Not assoc w R
kanamycin Not assoc w R
rifampicin Not assoc w R
amikacin Not assoc w R
pepQ 2860399 p.Arg7Gln missense_variant 1.0 clofazimine Uncertain significance
bedaquiline Uncertain significance
ald 3086788 c.-32T>C upstream_gene_variant 1.0 cycloserine
lpqB 3623239 p.Ala558Thr missense_variant 1.0 bedaquiline
mtrB 3625065 p.Met517Leu missense_variant 1.0 bedaquiline Uncertain significance
rifampicin Not assoc w R
alr 3841473 c.-53G>A upstream_gene_variant 1.0 cycloserine
panD 4044872 c.-591C>T upstream_gene_variant 1.0 pyrazinamide
glpK 4138622 c.1134C>T synonymous_variant 0.99 ethambutol Not assoc w R
moxifloxacin Not assoc w R
streptomycin Not assoc w R - Interim
levofloxacin Not assoc w R
rifampicin Not assoc w R
isoniazid Not assoc w R
embC 4242075 p.Arg738Gln missense_variant 1.0 ethambutol Not assoc w R
embC 4242643 c.2781C>T synonymous_variant 0.99 ethambutol Not assoc w R
whiB6 4338595 c.-75delG upstream_gene_variant 1.0 capreomycin Not assoc w R
amikacin Not assoc w R
kanamycin Not assoc w R
whiB6 4338732 c.-211C>T upstream_gene_variant 1.0 capreomycin
gid 4407588 c.615A>G synonymous_variant 0.99 streptomycin Not assoc w R