TB-Profiler result

Run: SRR28393577

Summary

Run ID: SRR28393577

Sample name:

Date: 2024-05-22T12:56:19.853515

Number of reads: 4059584

Percentage reads mapped: 99.45

Median coverage: 89.0

Strain: lineage4.1.2.1

Spoligotype:

Drug-resistance: Pre-XDR-TB


Download CSV Download TXT Download JSON
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family RDs Frequency
lineage4.1 Euro-American None 1.0
lineage4.1.2 Euro-American None 0.99
lineage4.1.2.1 Euro-American (Haarlem) RD182 1.0
lineage4 Euro-American None 1.0
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations WHO confidence Comment
rifampicin rpoB p.Ser450Leu Assoc w R
isoniazid katG p.Ser315Thr Assoc w R High-level resistance
ethambutol embB p.Met306Ile Assoc w R
pyrazinamide pncA p.Ala146Glu Assoc w R - Interim
streptomycin
fluoroquinolones
moxifloxacin gyrA p.Asp94Gly Assoc w R High-level resistance
ofloxacin
levofloxacin gyrA p.Asp94Gly Assoc w R
ciprofloxacin
aminoglycosides
amikacin
capreomycin tlyA c.175_176dupGA Assoc w R
kanamycin
cycloserine
ethionamide ethA c.174_195delCATGTACACGCTAGGTTTCCGA Assoc w R
clofazimine
para-aminosalicylic_acid
delamanid
bedaquiline
linezolid
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence Comment
gyrA 7582 p.Asp94Gly missense_variant 0.6 levofloxacin Assoc w R
moxifloxacin Assoc w R High-level resistance
rpoB 761155 p.Ser450Leu missense_variant 0.64 rifampicin Assoc w R
tlyA 1918113 c.175_176dupGA frameshift_variant 0.68 capreomycin Assoc w R
katG 2155168 p.Ser315Thr missense_variant 0.71 isoniazid Assoc w R High-level resistance
pncA 2288805 p.Ala146Glu missense_variant 0.82 pyrazinamide Assoc w R - Interim
embB 4247431 p.Met306Ile missense_variant 0.77 ethambutol Assoc w R
ethA 4327278 c.174_195delCATGTACACGCTAGGTTTCCGA frameshift_variant 0.62 ethionamide Assoc w R
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence
gyrA 7362 p.Glu21Gln missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 7585 p.Ser95Thr missense_variant 0.99 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 9304 p.Gly668Asp missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
fgd1 491591 p.Lys270Met missense_variant 1.0 clofazimine Not assoc w R
pretomanid
delamanid Uncertain significance
mshA 575679 p.Asn111Ser missense_variant 1.0 ethionamide Not assoc w R
isoniazid Not assoc w R
Rv0565c 657269 p.Ser68Pro missense_variant 1.0 ethionamide Uncertain significance
rpoB 760115 c.309C>T synonymous_variant 1.0 rifampicin Not assoc w R
rpoC 765150 p.Gly594Glu missense_variant 1.0 rifampicin Not assoc w R
rpoC 766467 p.Glu1033Ala missense_variant 0.7 rifampicin Uncertain significance
mmpL5 775639 p.Ile948Val missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
rpsL 781276 c.-284A>C upstream_gene_variant 1.0 streptomycin
rpsL 781395 c.-165T>C upstream_gene_variant 1.0 streptomycin Not assoc w R
rplC 800920 p.Arg38Cys missense_variant 0.36 linezolid Uncertain significance
rrs 1471659 n.-187C>T upstream_gene_variant 1.0 streptomycin
kanamycin
capreomycin
amikacin
tsnR 1854300 p.Leu232Pro missense_variant 1.0 linezolid Not assoc w R
tlyA 1917972 c.33A>G synonymous_variant 0.99 capreomycin Not assoc w R
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
kasA 2518076 c.-39C>T upstream_gene_variant 1.0 isoniazid
eis 2714847 c.484_485dupAG frameshift_variant 0.75 amikacin Uncertain significance
kanamycin Uncertain significance
eis 2715346 c.-14C>T upstream_gene_variant 0.74 amikacin Assoc w R - Interim
kanamycin Assoc w R
Rv2680 2996085 c.-20G>A upstream_gene_variant 0.29 capreomycin Uncertain significance
ald 3086788 c.-32T>C upstream_gene_variant 1.0 cycloserine
Rv3236c 3612846 p.Pro91Ser missense_variant 0.79 pyrazinamide Uncertain significance
mtrB 3625065 p.Met517Leu missense_variant 1.0 bedaquiline Uncertain significance
rifampicin Not assoc w R
embC 4239298 c.-565C>T upstream_gene_variant 1.0 ethambutol Not assoc w R
embC 4242643 c.2781C>T synonymous_variant 1.0 ethambutol Not assoc w R
embC 4242803 p.Val981Leu missense_variant 1.0 ethambutol Not assoc w R
ubiA 4269296 p.Met180Val missense_variant 0.69 ethambutol Uncertain significance
whiB6 4338595 c.-75delG upstream_gene_variant 1.0 capreomycin Not assoc w R
amikacin Not assoc w R
kanamycin Not assoc w R
whiB6 4338656 c.-135C>T upstream_gene_variant 0.66 capreomycin
amikacin
kanamycin
whiB6 4338732 c.-211C>T upstream_gene_variant 1.0 capreomycin
amikacin
kanamycin