TB-Profiler result

Run: ERR11068589


Run ID: ERR11068589

Sample name:

Date: 06-04-2023 18:24:49

Number of reads: 2513405

Percentage reads mapped: 99.59

Strain: lineage4.1.2

Drug-resistance: HR-TB

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.1 Euro-American T;X;H None 1.0
lineage4.1.2 Euro-American T;H None 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
fabG1 1673425 c.-15C>T upstream_gene_variant 1.0 isoniazid, ethionamide
ethR 4327876 p.Phe110Leu missense_variant 1.0 ethionamide
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
fgd1 491591 p.Lys270Met missense_variant 1.0
mshA 576108 p.Ala254Gly missense_variant 0.41
rpoB 760115 c.309C>T synonymous_variant 1.0
rpoC 765150 p.Gly594Glu missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rplC 800889 c.81C>A synonymous_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrs 1472580 n.735C>G non_coding_transcript_exon_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
PPE35 2168303 c.2310G>T synonymous_variant 1.0
PPE35 2169776 p.Phe279Leu missense_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
kasA 2518076 c.-39C>T upstream_gene_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
alr 3840263 c.1158C>T synonymous_variant 1.0
rpoA 3878580 c.-113_-74delCAACCCAACCCTCGGGGGGCGCCGCCCCCCGAGTACCCCC upstream_gene_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embC 4242803 p.Val981Leu missense_variant 1.0
embB 4246584 p.Arg24Pro missense_variant 0.23
embB 4247024 p.Pro171Ala missense_variant 0.27
embB 4249465 c.2952G>C synonymous_variant 1.0
aftB 4267745 c.1092G>C synonymous_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0