TB-Profiler result

Run: ERR2515590

Summary

Run ID: ERR2515590

Sample name:

Date: 13-08-2022 22:36:50

Number of reads: 2625864

Percentage reads mapped: 99.57

Strain: lineage4.1.2

Drug-resistance: Pre-XDR-TB


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.1 Euro-American T;X;H None 1.0
lineage4.1.2 Euro-American T;H None 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
gyrA 7582 p.Asp94Ala missense_variant 1.0 ofloxacin, moxifloxacin, levofloxacin, fluoroquinolones, ciprofloxacin
rpoB 761100 p.Gln432Lys missense_variant 1.0 rifampicin
katG 2155168 p.Ser315Thr missense_variant 1.0 isoniazid
pncA 2289089 p.His51Gln missense_variant 1.0 pyrazinamide
embB 4247429 p.Met306Leu missense_variant 1.0 ethambutol
gid 4408100 c.102delG frameshift_variant 1.0 streptomycin
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 0.99
fgd1 491591 p.Lys270Met missense_variant 1.0
mshA 576766 c.1419G>A synonymous_variant 1.0
rpoB 760115 c.309C>T synonymous_variant 1.0
rpoB 760657 p.Glu284Gly missense_variant 0.99
rpoC 763555 c.186C>T synonymous_variant 1.0
rpoC 765150 p.Gly594Glu missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpL5 778134 c.345_346delAC frameshift_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1303434 p.Asp168Glu missense_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
PPE35 2168990 c.1545_1622delGGCGATGACGCCAGCTAACATCACGGTGGGTGCGTTTGATTTGCCGGGGTTGACGGTGCCGTCGTTGACGATTCCAGC disruptive_inframe_deletion 1.0
PPE35 2169071 c.1542A>G synonymous_variant 0.25
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
pncA 2290171 c.-930G>T upstream_gene_variant 0.98
kasA 2518076 c.-39C>T upstream_gene_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 0.99
rpoA 3878676 c.-169G>T upstream_gene_variant 0.12
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embC 4242803 p.Val981Leu missense_variant 1.0
embB 4248551 p.Ala680Thr missense_variant 1.0
ethA 4326918 p.Thr186Pro missense_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4408082 p.Val41Ile missense_variant 1.0
PPE35 2168990 c.1544_1622delNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT frameshift_variant 1.0