TB-Profiler result

Run: ERR2515590


Run ID: ERR2515590

Sample name:

Date: 2024-04-14T16:16:21.977500

Number of reads: 2612521

Percentage reads mapped: 99.57

Median coverage: 107.0

Strain: lineage4.1.2


Drug-resistance: Pre-XDR-TB

Download CSV Download TXT Download JSON
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family RDs Frequency
lineage4.1 Euro-American None 1.0
lineage4.1.2 Euro-American None 1.0
lineage4 Euro-American None 1.0
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations WHO confidence Comment
rifampicin rpoB p.Gln432Lys Assoc w R
isoniazid katG p.Ser315Thr Assoc w R High-level resistance
ethambutol embB p.Met306Leu Assoc w R
pyrazinamide pncA p.His51Gln Assoc w R
streptomycin gid c.102delG Assoc w R
moxifloxacin gyrA p.Asp94Ala Assoc w R Low-level resistance (multiple, genetically linked low-level resistance mutations are additive and confer high-level resistance)
levofloxacin gyrA p.Asp94Ala Assoc w R
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence Comment
gyrA 7582 p.Asp94Ala missense_variant 1.0 levofloxacin Assoc w R
moxifloxacin Assoc w R Low-level resistance (multiple, genetically linked low-level resistance mutations are additive and confer high-level resistance)
rpoB 761100 p.Gln432Lys missense_variant 1.0 rifampicin Assoc w R
katG 2155168 p.Ser315Thr missense_variant 1.0 isoniazid Assoc w R High-level resistance
pncA 2289089 p.His51Gln missense_variant 1.0 pyrazinamide Assoc w R
embB 4247429 p.Met306Leu missense_variant 1.0 ethambutol Assoc w R
gid 4408100 c.102delG frameshift_variant 1.0 streptomycin Assoc w R
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence
gyrA 7362 p.Glu21Gln missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 7585 p.Ser95Thr missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 9304 p.Gly668Asp missense_variant 0.99 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
fgd1 491591 p.Lys270Met missense_variant 1.0 clofazimine Not assoc w R
delamanid Uncertain significance
mshA 576766 c.1419G>A synonymous_variant 1.0 ethionamide Not assoc w R - Interim
isoniazid Not assoc w R - Interim
Rv0565c 657269 p.Ser68Pro missense_variant 1.0 ethionamide Uncertain significance
rpoB 760115 c.309C>T synonymous_variant 1.0 rifampicin Not assoc w R
rpoB 760657 p.Glu284Gly missense_variant 0.99 rifampicin Uncertain significance
rpoC 763555 c.186C>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 765150 p.Gly594Glu missense_variant 1.0 rifampicin Not assoc w R
mmpL5 775639 p.Ile948Val missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
mmpL5 778134 c.345_346delAC frameshift_variant 1.0 clofazimine Uncertain significance
bedaquiline Uncertain significance
rpsL 781395 c.-165T>C upstream_gene_variant 1.0 streptomycin Not assoc w R
fbiC 1303434 p.Asp168Glu missense_variant 1.0 clofazimine Uncertain significance
delamanid Uncertain significance
rrs 1471659 n.-187C>T upstream_gene_variant 1.0 streptomycin
tsnR 1854300 p.Leu232Pro missense_variant 1.0 linezolid Not assoc w R
tlyA 1917972 c.33A>G synonymous_variant 1.0 capreomycin Not assoc w R
PPE35 2168990 c.1544_1622delNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT frameshift_variant 1.0 pyrazinamide Uncertain significance
PPE35 2168990 c.1545_1622delGGCGATGACGCCAGCTAACATCACGGTGGGTGCGTTTGATTTGCCGGGGTTGACGGTGCCGTCGTTGACGATTCCAGC disruptive_inframe_deletion 0.62 pyrazinamide Uncertain significance
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
pncA 2290171 c.-930G>T upstream_gene_variant 0.98 pyrazinamide
kasA 2518076 c.-39C>T upstream_gene_variant 1.0 isoniazid
Rv2680 2996034 c.-71G>A upstream_gene_variant 0.26 capreomycin Uncertain significance
Rv2680 2996136 p.Ser11Asn missense_variant 0.15 capreomycin
ald 3086788 c.-32T>C upstream_gene_variant 1.0 cycloserine
mtrB 3625065 p.Met517Leu missense_variant 1.0 bedaquiline Uncertain significance
rifampicin Not assoc w R
embC 4242643 c.2781C>T synonymous_variant 1.0 ethambutol Not assoc w R
embC 4242803 p.Val981Leu missense_variant 1.0 ethambutol Not assoc w R
embB 4248551 p.Ala680Thr missense_variant 1.0 ethambutol Uncertain significance
ethA 4326918 p.Thr186Pro missense_variant 1.0 ethionamide Uncertain significance
whiB6 4338595 c.-75delG upstream_gene_variant 1.0 capreomycin Not assoc w R
amikacin Not assoc w R
kanamycin Not assoc w R
whiB6 4338732 c.-211C>T upstream_gene_variant 1.0 capreomycin
gid 4408082 p.Val41Ile missense_variant 1.0 streptomycin Uncertain significance