TB-Profiler result

Run: ERR2515614


Run ID: ERR2515614

Sample name:

Date: 20-10-2023 14:22:42

Number of reads: 1044788

Percentage reads mapped: 99.86

Strain: lineage4.3.3

Drug-resistance: Pre-XDR-TB

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Rifampicin R rpoB p.Ser450Leu (1.00)
Isoniazid R fabG1 c.-8T>A (1.00), katG p.Ser315Thr (1.00)
Ethambutol R embB p.Met306Ile (1.00), embB p.Asp1024Asn (1.00)
Pyrazinamide R pncA c.389delT (1.00), pncA c.389delT (1.00)
Fluoroquinolones R gyrB p.Asp461Asn (1.00)
Moxifloxacin R gyrB p.Asp461Asn (1.00)
Ofloxacin R gyrB p.Asp461Asn (1.00)
Levofloxacin R gyrB p.Asp461Asn (1.00)
Ciprofloxacin R gyrB p.Asp461Asn (1.00)
Cycloserine R alr p.Leu113Arg (1.00)
Ethionamide R ethA c.-11A>G (1.00)
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.3 Euro-American (LAM) mainly-LAM None 1.0
lineage4.3.3 Euro-American (LAM) LAM;T RD115 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
gyrB 6620 p.Asp461Asn missense_variant 1.0 ofloxacin, moxifloxacin, levofloxacin, fluoroquinolones, ciprofloxacin
rpoB 761155 p.Ser450Leu missense_variant 1.0 rifampicin
fabG1 1673432 c.-8T>A upstream_gene_variant 1.0 isoniazid
katG 2155168 p.Ser315Thr missense_variant 1.0 isoniazid
pncA 2288852 c.389delT frameshift_variant 1.0 pyrazinamide, pyrazinamide
alr 3841083 p.Leu113Arg missense_variant 1.0 cycloserine
embB 4247431 p.Met306Ile missense_variant 1.0 ethambutol
embB 4249583 p.Asp1024Asn missense_variant 1.0 ethambutol
ethA 4327484 c.-11A>G upstream_gene_variant 1.0 ethionamide
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 8040 p.Gly247Ser missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
rpoC 764840 p.Ile491Val missense_variant 1.0
rpoC 764995 c.1626C>G synonymous_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 0.99
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.41
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrl 1476056 n.2399G>A non_coding_transcript_exon_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
Rv1979c 2223051 p.Glu38Asp missense_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
kasA 2518919 p.Gly269Ser missense_variant 1.0
Rv2752c 3065824 p.Pro123Leu missense_variant 1.0
thyA 3073868 p.Thr202Ala missense_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
clpC1 4038287 c.2418C>T synonymous_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4408156 p.Leu16Arg missense_variant 1.0
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0
gid 4407912 c.160_290del frameshift_variant 1.0