TB-Profiler result

Run: ERR2517063

Summary

Run ID: ERR2517063

Sample name:

Date: 31-03-2023 21:55:07

Number of reads: 5550606

Percentage reads mapped: 99.52

Strain: lineage3

Drug-resistance: MDR-TB


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage3 East-African-Indian CAS RD750 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
rpoB 761155 p.Ser450Leu missense_variant 1.0 rifampicin
rrs 1472362 n.517C>T non_coding_transcript_exon_variant 1.0 streptomycin
katG 2155168 p.Ser315Thr missense_variant 1.0 isoniazid
pncA 2288968 c.252_273dupTCTGGACACGTCGGCAATCGAG frameshift_variant 0.96 pyrazinamide
embB 4247730 p.Gly406Ala missense_variant 1.0 ethambutol
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrB 6732 p.Lys498Arg missense_variant 1.0
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
fgd1 491742 c.960T>C synonymous_variant 1.0
rpoB 759746 c.-61C>T upstream_gene_variant 1.0
rpoC 762434 c.-936T>G upstream_gene_variant 1.0
rpoC 763031 c.-339T>C upstream_gene_variant 1.0
rpoC 767123 p.Val1252Leu missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpL5 776100 p.Thr794Ile missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
katG 2154724 p.Arg463Leu missense_variant 1.0
PPE35 2167926 p.Leu896Ser missense_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
pncA 2289047 c.195C>T synonymous_variant 1.0
pncA 2289365 c.-125delC upstream_gene_variant 0.99
ahpC 2726105 c.-88G>A upstream_gene_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
embC 4242075 p.Arg738Gln missense_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embB 4249063 c.2550C>T synonymous_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4407588 c.615A>G synonymous_variant 1.0