TB-Profiler result

Run: ERR2653116

Summary

Run ID: ERR2653116

Sample name:

Date: 31-03-2023 22:32:19

Number of reads: 1615947

Percentage reads mapped: 99.4

Strain: lineage4.8

Drug-resistance: Pre-XDR-TB


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.8 Euro-American (mainly T) T1;T2;T3;T5 RD219 0.99
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
gyrB 6735 p.Asn499Thr missense_variant 1.0 ofloxacin, moxifloxacin, levofloxacin, fluoroquinolones, ciprofloxacin
gyrA 7572 p.Ser91Pro missense_variant 1.0 ofloxacin, moxifloxacin, levofloxacin, fluoroquinolones, ciprofloxacin
rpoB 761155 p.Ser450Leu missense_variant 0.98 rifampicin
rpsL 781687 p.Lys43Arg missense_variant 1.0 streptomycin
rrs 1473246 n.1401A>G non_coding_transcript_exon_variant 1.0 kanamycin, capreomycin, aminoglycosides, amikacin
katG 2155168 p.Ser315Thr missense_variant 1.0 isoniazid
embB 4247429 p.Met306Val missense_variant 1.0 ethambutol
ethA 4327081 p.Cys131* stop_gained 0.99 ethionamide
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
rpoC 766487 p.Pro1040Ala missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrl 1474001 n.344C>T non_coding_transcript_exon_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
pncA 2289241 c.1A>C initiator_codon_variant 0.98
pepQ 2859978 p.Cys147Trp missense_variant 0.98
thyA 3074510 c.-39C>A upstream_gene_variant 1.0
ald 3087852 c.1036_1057dupCACGAAGGGGCGTTACTGTCCG frameshift_variant 0.58
alr 3840764 c.657G>C synonymous_variant 0.99
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embB 4246544 p.Thr11Pro missense_variant 0.15
embB 4246548 p.Pro12Gln missense_variant 0.1
embB 4246556 p.Ala15Pro missense_variant 0.1
ubiA 4269089 p.Ala249Thr missense_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
Rv3083 3448507 c.5_*1408del frameshift_variant&stop_lost&splice_region_variant 1.0